ID: 972127041

View in Genome Browser
Species Human (GRCh38)
Location 4:35780929-35780951
Sequence CACTTCCTATTAAGGATCAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972127038_972127041 14 Left 972127038 4:35780892-35780914 CCCTCTGTAATCATACTTGAAAA No data
Right 972127041 4:35780929-35780951 CACTTCCTATTAAGGATCAAAGG No data
972127037_972127041 15 Left 972127037 4:35780891-35780913 CCCCTCTGTAATCATACTTGAAA No data
Right 972127041 4:35780929-35780951 CACTTCCTATTAAGGATCAAAGG No data
972127039_972127041 13 Left 972127039 4:35780893-35780915 CCTCTGTAATCATACTTGAAAAT No data
Right 972127041 4:35780929-35780951 CACTTCCTATTAAGGATCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972127041 Original CRISPR CACTTCCTATTAAGGATCAA AGG Intergenic
No off target data available for this crispr