ID: 972135124

View in Genome Browser
Species Human (GRCh38)
Location 4:35883514-35883536
Sequence ATTTTATACAGTATCTATTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972135122_972135124 2 Left 972135122 4:35883489-35883511 CCTAGATTTTGCTCCAACTGAGT No data
Right 972135124 4:35883514-35883536 ATTTTATACAGTATCTATTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972135124 Original CRISPR ATTTTATACAGTATCTATTT TGG Intergenic
No off target data available for this crispr