ID: 972136821

View in Genome Browser
Species Human (GRCh38)
Location 4:35903284-35903306
Sequence CCTAGGCACCCCTTGTGCAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972136811_972136821 17 Left 972136811 4:35903244-35903266 CCCCCATTCCTGAAAACTCTTGT No data
Right 972136821 4:35903284-35903306 CCTAGGCACCCCTTGTGCATGGG No data
972136812_972136821 16 Left 972136812 4:35903245-35903267 CCCCATTCCTGAAAACTCTTGTT No data
Right 972136821 4:35903284-35903306 CCTAGGCACCCCTTGTGCATGGG No data
972136815_972136821 9 Left 972136815 4:35903252-35903274 CCTGAAAACTCTTGTTACTCAGA No data
Right 972136821 4:35903284-35903306 CCTAGGCACCCCTTGTGCATGGG No data
972136814_972136821 14 Left 972136814 4:35903247-35903269 CCATTCCTGAAAACTCTTGTTAC No data
Right 972136821 4:35903284-35903306 CCTAGGCACCCCTTGTGCATGGG No data
972136813_972136821 15 Left 972136813 4:35903246-35903268 CCCATTCCTGAAAACTCTTGTTA No data
Right 972136821 4:35903284-35903306 CCTAGGCACCCCTTGTGCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972136821 Original CRISPR CCTAGGCACCCCTTGTGCAT GGG Intergenic
No off target data available for this crispr