ID: 972137445

View in Genome Browser
Species Human (GRCh38)
Location 4:35909165-35909187
Sequence CTGTAAGATCAAAAGCAAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972137445_972137449 -6 Left 972137445 4:35909165-35909187 CCAACTTGCTTTTGATCTTACAG No data
Right 972137449 4:35909182-35909204 TTACAGGCTCATAGGCAGAAGGG 0: 715
1: 1101
2: 1551
3: 1346
4: 1096
972137445_972137451 29 Left 972137445 4:35909165-35909187 CCAACTTGCTTTTGATCTTACAG No data
Right 972137451 4:35909217-35909239 TCAGATGAGACTTCAGACTGTGG 0: 12
1: 61
2: 995
3: 1347
4: 1235
972137445_972137448 -7 Left 972137445 4:35909165-35909187 CCAACTTGCTTTTGATCTTACAG No data
Right 972137448 4:35909181-35909203 CTTACAGGCTCATAGGCAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972137445 Original CRISPR CTGTAAGATCAAAAGCAAGT TGG (reversed) Intergenic
No off target data available for this crispr