ID: 972144982

View in Genome Browser
Species Human (GRCh38)
Location 4:36012584-36012606
Sequence TACATTTTGAAGAACATGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 510
Summary {0: 1, 1: 0, 2: 3, 3: 34, 4: 472}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972144982_972144985 12 Left 972144982 4:36012584-36012606 CCATCCATGTTCTTCAAAATGTA 0: 1
1: 0
2: 3
3: 34
4: 472
Right 972144985 4:36012619-36012641 GATCAGAAGAACTCCTTTAAAGG 0: 1
1: 0
2: 0
3: 10
4: 132
972144982_972144986 13 Left 972144982 4:36012584-36012606 CCATCCATGTTCTTCAAAATGTA 0: 1
1: 0
2: 3
3: 34
4: 472
Right 972144986 4:36012620-36012642 ATCAGAAGAACTCCTTTAAAGGG 0: 1
1: 0
2: 5
3: 20
4: 241
972144982_972144987 16 Left 972144982 4:36012584-36012606 CCATCCATGTTCTTCAAAATGTA 0: 1
1: 0
2: 3
3: 34
4: 472
Right 972144987 4:36012623-36012645 AGAAGAACTCCTTTAAAGGGCGG 0: 1
1: 0
2: 0
3: 11
4: 188

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972144982 Original CRISPR TACATTTTGAAGAACATGGA TGG (reversed) Intronic
900388809 1:2424520-2424542 GTCATTTTCAACAACATGGATGG - Intergenic
900928862 1:5723481-5723503 GTCATTTTCAACAACATGGATGG - Intergenic
901340467 1:8494285-8494307 TTTATTTTAAAGCACATGGAGGG - Intronic
902316759 1:15626292-15626314 TACATTTTAAATAACATAGTAGG + Intronic
902938182 1:19779865-19779887 TATGATTTGAAGTACATGGAGGG - Intronic
904055505 1:27667486-27667508 CACTTTTTGAACACCATGGAGGG - Intronic
904525947 1:31134009-31134031 TACATTTTGAAAATCAATGATGG - Intergenic
905033275 1:34901809-34901831 TCGATTATGAAGGACATGGAAGG + Intronic
906914779 1:49996311-49996333 TAAATATTAAAGAATATGGATGG + Intronic
907102479 1:51849518-51849540 AACATTTTGAAAAAGATGGCCGG + Intronic
908643301 1:66249035-66249057 TGCAATTTGAAGAACATGGATGG - Intronic
908908388 1:69042869-69042891 GTCATTTTCAACAACATGGATGG + Intergenic
908975652 1:69894683-69894705 ACCATTTTTAAAAACATGGATGG + Intronic
909101539 1:71355471-71355493 ATCATTTTCAAGAACATGGATGG - Intergenic
909128916 1:71710562-71710584 TTCATTTGCAACAACATGGATGG + Intronic
909401595 1:75238322-75238344 TTCATTAAGAAGAACATGTAAGG - Intronic
909813145 1:79956408-79956430 TACATTGTGATGACCATGAATGG + Intergenic
910253080 1:85218744-85218766 TATATTTTGAAGAACTTAAAAGG + Intergenic
910929327 1:92427296-92427318 AACTCTTAGAAGAACATGGAGGG + Intergenic
912139647 1:106707628-106707650 GTCCTTTAGAAGAACATGGATGG - Intergenic
912327033 1:108775709-108775731 GACATTTACAACAACATGGATGG - Intronic
912596596 1:110884804-110884826 TACATTTTAAAGTAAAAGGATGG - Intronic
913590832 1:120322995-120323017 CACATTTTCAAGGACCTGGAAGG + Intergenic
913617138 1:120572221-120572243 CACATTTTCAAGGACCTGGAAGG + Intergenic
914573138 1:148938693-148938715 CACATTTTCAAGGACCTGGAAGG - Intronic
914599981 1:149194947-149194969 CACATTTTCAAGGACCTGGAAGG - Intergenic
914778697 1:150763127-150763149 GTCATTTTCAACAACATGGATGG + Intronic
915381597 1:155446208-155446230 TAAATTTAGAAAAACATGTACGG - Intronic
915786317 1:158616555-158616577 GACATTTTCAGTAACATGGATGG - Intronic
915948102 1:160168944-160168966 TTTATTTTGAATCACATGGACGG - Intronic
916257665 1:162806394-162806416 CATATTTTGAAAAACCTGGAAGG - Intronic
916362021 1:163981019-163981041 TACATGTTAGAGAACCTGGAGGG + Intergenic
916425740 1:164677969-164677991 TCCATTTTAAAGAAAATGTATGG + Intronic
917584104 1:176407597-176407619 TACATTTGGGAGAAAATGCATGG + Intergenic
918535389 1:185568569-185568591 TACATATTAAAGAAAAAGGAAGG - Intergenic
918998369 1:191793597-191793619 TAAATTTTAAAGAATATGGTAGG + Intergenic
919222916 1:194654694-194654716 TTCATTTTGGAAAACCTGGATGG + Intergenic
919343225 1:196340768-196340790 TACATTTTAATGAAAATGAATGG + Intronic
919599446 1:199604492-199604514 TAATTTTTGAATAACATGTAAGG - Intergenic
919933965 1:202239287-202239309 TAAATTCTGAAGAATTTGGAAGG + Intronic
921979958 1:221245720-221245742 GACCTTTGCAAGAACATGGATGG - Intergenic
922065095 1:222129595-222129617 GCCATTTTCAACAACATGGATGG + Intergenic
924086515 1:240457340-240457362 TACAGTTTGAAGAATGTGGAAGG - Intronic
924187361 1:241507927-241507949 TACATTGTGAAGGAAATGTAAGG - Intronic
924875038 1:248093705-248093727 TTCATTTGCAACAACATGGATGG - Intronic
1063305474 10:4895402-4895424 GTCATTTGCAAGAACATGGATGG - Intergenic
1064110285 10:12532780-12532802 GTCATTTTCAACAACATGGATGG + Intronic
1064126699 10:12667864-12667886 AATATTTTGAAGATCATGAAAGG - Intronic
1064588356 10:16862858-16862880 AACATTTTGAAAAACACTGAAGG - Intronic
1065876936 10:30005341-30005363 TTCATTTGCAATAACATGGATGG - Intergenic
1065989122 10:30990747-30990769 TACCTGTTGAAGAACCTGGGAGG - Intronic
1066181127 10:32961624-32961646 GACATTTTGAAAAACAAGAAGGG + Intronic
1066724112 10:38372073-38372095 CATATTTTGAAAAACCTGGAAGG - Intergenic
1066792309 10:39079305-39079327 GACATTTTGAAGAATCTGCAAGG + Intergenic
1067740688 10:48894001-48894023 TTCATTTTGTAGAACATGTAGGG + Intronic
1068094390 10:52472259-52472281 AACATATTGAAGATCATAGATGG + Intergenic
1068147513 10:53090085-53090107 TTGATGTTGAAGAACATTGATGG + Intergenic
1069233419 10:66040565-66040587 TTCCTTTGCAAGAACATGGATGG + Intronic
1070905123 10:80065493-80065515 CAAATTTTGAAGAACCTAGATGG + Intergenic
1072896485 10:99371862-99371884 TCCATTTTGGAGAACAGAGATGG + Intronic
1073231241 10:101972416-101972438 TACAGTTTGCAGCACATGTATGG + Intronic
1074701193 10:116094152-116094174 GACATTTTCAAGAAAATGCAAGG - Intronic
1076395041 10:130132210-130132232 GCCATGTTGAAGAACATGGTGGG + Intergenic
1077778629 11:5300065-5300087 AACACTTTGAAGAAGATTGAAGG + Intronic
1077961213 11:7078487-7078509 TACATTTTAAAGAAATTAGAGGG + Intergenic
1078136798 11:8658436-8658458 GTCATTTTGGGGAACATGGAGGG - Intronic
1078610723 11:12816886-12816908 GGCATCTTGAAGAACAGGGAGGG - Intronic
1079661633 11:23044253-23044275 CACATTTGCAACAACATGGATGG - Intergenic
1079694884 11:23469169-23469191 TAAATTTTGAAGCAAATGGGAGG + Intergenic
1079919314 11:26412526-26412548 TATATTTTGAGGAGCATGGCTGG + Intronic
1080054698 11:27894055-27894077 TGCACTTTGAAGATCAAGGAAGG + Intergenic
1080251128 11:30234862-30234884 CAGATTTGGGAGAACATGGATGG - Exonic
1081307323 11:41529452-41529474 TATATTTGGAGGAAAATGGATGG + Intergenic
1082216227 11:49573162-49573184 TACAACATGAAGAACATGGGAGG - Intergenic
1082601394 11:55160975-55160997 TACTTTTTGAGGAAGATGCAAGG - Intergenic
1083152083 11:60798202-60798224 TCCCTTTTCAAGAACAGGGAGGG + Intronic
1086506533 11:87510296-87510318 TCCATTTTGATGAACATGTTAGG + Intergenic
1086633360 11:89051318-89051340 TACAACATGAAGAACATGGGAGG + Intronic
1087236949 11:95730643-95730665 TACATTTGGAAGAACAGGATTGG - Intergenic
1087305264 11:96482268-96482290 TACAAATTGAAGAACATGGGAGG - Intronic
1087567667 11:99883020-99883042 TTCATTTGCAACAACATGGATGG - Intronic
1088517755 11:110656949-110656971 TACCTTTGGAAGAGCATGGGAGG - Intronic
1089463765 11:118669533-118669555 GCCATTTGCAAGAACATGGATGG + Intronic
1090001524 11:122964431-122964453 TACATTTTGAAGCACATCTTGGG - Intergenic
1090646780 11:128772865-128772887 TCCTTTTTCCAGAACATGGATGG + Exonic
1090813633 11:130270548-130270570 TACTTTTTGAAGAAGATTGTAGG - Intronic
1090815526 11:130290945-130290967 TTCATTTTGCAGAGCAGGGAGGG - Intronic
1092771602 12:11902289-11902311 TTCAGTTTGAACATCATGGAAGG + Intergenic
1093796537 12:23320079-23320101 GTCATTTTCAACAACATGGATGG + Intergenic
1094246131 12:28295984-28296006 AACAGTTTGAAGAATATGGGAGG - Intronic
1094500238 12:31015120-31015142 AAGATCTTGATGAACATGGATGG - Intergenic
1095458933 12:42420943-42420965 TAGATTTAGAATTACATGGAAGG - Intronic
1097431287 12:59510910-59510932 TTCATTTGCAACAACATGGATGG + Intergenic
1098871342 12:75820629-75820651 CACCTTTTGAATAACAGGGAAGG + Intergenic
1098919311 12:76289037-76289059 TACATTTTAAATAACCTGAAAGG + Intergenic
1099003603 12:77210872-77210894 ATCATTTTCAACAACATGGATGG - Intergenic
1099257946 12:80338834-80338856 TAAATTTTGAGGAAAATGAAAGG + Intronic
1099760066 12:86909564-86909586 TACTCTTTGAAGAAAATGAAAGG + Intergenic
1099763695 12:86954519-86954541 TTCATTTGTAACAACATGGATGG - Intergenic
1100033803 12:90225767-90225789 AACATTTTGAAAAACATGTCTGG - Intergenic
1101291862 12:103378356-103378378 TGCCTTTTGAAGAAGCTGGATGG - Intronic
1105322458 13:19340852-19340874 GACATTTACAACAACATGGATGG + Intergenic
1105335844 13:19467995-19468017 GTCATTTGGAACAACATGGATGG - Intronic
1105607607 13:21939734-21939756 TACATAATGAAGCCCATGGAAGG + Intergenic
1105798843 13:23885140-23885162 GTCATTTTCAACAACATGGATGG + Intronic
1107213853 13:37891927-37891949 TATTTAATGAAGAACATGGATGG + Intergenic
1107216241 13:37922280-37922302 TTCATTTGCAACAACATGGATGG - Intergenic
1107849213 13:44553236-44553258 TACATTTTGAAGAAGAAAGACGG - Intronic
1108132273 13:47315456-47315478 TATATTTTTTAAAACATGGAAGG + Intergenic
1109381791 13:61571107-61571129 TATCTTTTGAAGAAGGTGGAAGG - Intergenic
1109581957 13:64351602-64351624 TAGAGTTTGAAAAAGATGGAGGG - Intergenic
1110124884 13:71930359-71930381 AAAATTTGGATGAACATGGAGGG - Intergenic
1110885916 13:80635592-80635614 GTCATTTGCAAGAACATGGATGG - Intergenic
1110941770 13:81359784-81359806 GACATTTGCAACAACATGGATGG - Intergenic
1110997124 13:82124339-82124361 GTCATTTTCAACAACATGGATGG - Intergenic
1111152150 13:84267776-84267798 AAGATTTTGAAGAAAATGAATGG + Intergenic
1111297530 13:86301944-86301966 TACATTTTTAGGAAAAAGGATGG - Intergenic
1111739683 13:92188220-92188242 TACATTTGGAACTGCATGGAAGG - Intronic
1112859784 13:103816267-103816289 GGCATTTTGAAGAAGATGAAGGG + Intergenic
1114987423 14:28248549-28248571 GTCATTTTCAACAACATGGATGG - Intergenic
1115708561 14:36024877-36024899 GACATTTGTAACAACATGGATGG - Intergenic
1115805075 14:37041701-37041723 TACATATTTAAGCACATGGCTGG - Intronic
1115875992 14:37862850-37862872 TACATTTTAAAGAAAGTAGATGG - Intronic
1116187084 14:41610278-41610300 TGAATATTGAAGAATATGGAAGG + Intronic
1117244365 14:53869448-53869470 GTCTTTTTCAAGAACATGGATGG + Intergenic
1117722684 14:58642782-58642804 AACATTCTGGAGAACATGAAAGG - Intronic
1117786924 14:59295699-59295721 TACTTTGTGTAGAAAATGGATGG - Intronic
1117949944 14:61072681-61072703 TTCATTTGCAACAACATGGATGG - Intronic
1118652689 14:67914380-67914402 GTCATTTTCAACAACATGGATGG - Intronic
1120415217 14:84210499-84210521 TTAGTTTTGAAGAACAAGGAGGG - Intergenic
1121756410 14:96406387-96406409 TACATTTTAAAGCTCATGAAAGG - Intronic
1122654985 14:103252293-103252315 GTCATTTTCAAAAACATGGATGG + Intergenic
1123177345 14:106433389-106433411 GACATTTGCAATAACATGGATGG + Intergenic
1123214944 14:106799856-106799878 AACATTTCCAACAACATGGATGG + Intergenic
1125173091 15:36789452-36789474 TACATCTTGAAAAACTAGGAAGG - Intronic
1125215053 15:37262615-37262637 TATATTTTGGAGAAAATGCATGG - Intergenic
1126305482 15:47250873-47250895 TACATTTTCAAAAAGGTGGAAGG + Intronic
1126874524 15:53025731-53025753 GTCATTTTCAACAACATGGATGG - Intergenic
1130570773 15:85041575-85041597 TACATTTTTAACAAAATGGTGGG - Intronic
1130873002 15:87986194-87986216 GATATTTTGAAGTACAAGGAAGG - Intronic
1131809482 15:96158018-96158040 GACAGTGTGAAGAACATAGAAGG - Intergenic
1131879531 15:96847865-96847887 GCCATTTTCAACAACATGGATGG + Intergenic
1133628230 16:7592310-7592332 TACATTTTGAATCCCAAGGAAGG - Intronic
1133668308 16:7992839-7992861 TACATTCTGAAAACCAGGGAGGG - Intergenic
1134795602 16:17033195-17033217 TTCATTTTAAACAACATGGTGGG + Intergenic
1135485658 16:22862603-22862625 TTCATTTTCAGGAACCTGGATGG + Intronic
1136695102 16:32072402-32072424 GACATTTGCAACAACATGGATGG - Intergenic
1136795602 16:33015661-33015683 GACATTTGCAACAACATGGATGG - Intergenic
1136874317 16:33838720-33838742 GACATTTGCAACAACATGGATGG + Intergenic
1138792326 16:59920454-59920476 TTCATAGTGAAAAACATGGAAGG + Intergenic
1138890609 16:61139900-61139922 AACATTTGCAACAACATGGATGG - Intergenic
1140122456 16:72095396-72095418 TAAAGTATGGAGAACATGGACGG + Intronic
1140252066 16:73302931-73302953 TACATTTTTAAAATCATGGATGG + Intergenic
1141014151 16:80432400-80432422 GTCATTTTCAACAACATGGATGG + Intergenic
1141018956 16:80477131-80477153 TGCATTTTGATTAACATTGAAGG - Intergenic
1141301442 16:82819708-82819730 TACATTTTGAAGAAGAAAGGAGG - Intronic
1203097862 16_KI270728v1_random:1277319-1277341 GACATTTGCAACAACATGGATGG - Intergenic
1145202335 17:20957624-20957646 TGCATATTGAAAGACATGGAAGG + Intergenic
1145224864 17:21119644-21119666 TGCATTTTTAAGAACATTGTTGG - Intergenic
1145729969 17:27171526-27171548 TACATTTTGGAGCAAATTGAGGG + Intergenic
1146975695 17:37109678-37109700 TAACTTTTGAAGCACATGAAGGG - Intronic
1149572979 17:57687432-57687454 TACAATATGAAGAATATGAAAGG + Intergenic
1150840603 17:68602041-68602063 TTCCTTTTGAAGAAGAGGGAGGG + Intergenic
1152217459 17:79042149-79042171 TACATTTTGGTGAACAAAGAGGG + Intronic
1152232779 17:79122892-79122914 GTCATTTTCAACAACATGGATGG + Intronic
1152256315 17:79242049-79242071 CACATTTAGGAAAACATGGAAGG - Intronic
1155032890 18:21999955-21999977 TACATTTTAAAGAAAATACATGG + Intergenic
1155630312 18:27885584-27885606 TACATATTGAAGAATGTGGTTGG - Intergenic
1155763847 18:29602798-29602820 GTCATTTGGAACAACATGGATGG + Intergenic
1155895551 18:31321440-31321462 AATATTTTGTAGAAAATGGAAGG + Intronic
1156277615 18:35598534-35598556 ATCATTTTCAACAACATGGATGG - Intronic
1156715364 18:40002561-40002583 TGTATTTTGCAGAACATGGATGG + Intergenic
1157156513 18:45272416-45272438 AACATTTGCAACAACATGGATGG - Intronic
1158039122 18:53071006-53071028 TATATTTTGAAGTACATTGTGGG + Intronic
1158145049 18:54302923-54302945 AACATTTGCAACAACATGGATGG - Intronic
1158173687 18:54628733-54628755 TGGGTTTTGAAGAAGATGGATGG + Intergenic
1159091277 18:63852072-63852094 TACATTGTGAAGAAGAAGCAAGG - Intergenic
1159316014 18:66773815-66773837 TACATTCTTAAGAACAGTGAAGG - Intergenic
1159710870 18:71757954-71757976 GTCATTTTCAACAACATGGATGG + Intronic
1160155194 18:76428709-76428731 TACATTTTAAAGACCTAGGAGGG + Intronic
1162287654 19:9751565-9751587 TACATTCAGAAGAGCAGGGAGGG - Intergenic
1163894247 19:20043620-20043642 TACCTTTTGAAGCCCATAGATGG + Intergenic
1164801193 19:31078277-31078299 TTAATTTTGAAGAACATTGAGGG - Intergenic
1167178414 19:47882457-47882479 CACAATGGGAAGAACATGGAAGG + Intronic
925117680 2:1394330-1394352 TTCATTTTGACGACCATGGAGGG + Intronic
925487541 2:4352510-4352532 TCCATTTTGAAGAACATTCTTGG - Intergenic
926235482 2:11039985-11040007 ATGAATTTGAAGAACATGGAGGG - Intergenic
926420399 2:12690990-12691012 GTCATTTTCAAGAACATGGATGG + Intergenic
927123788 2:19994712-19994734 TAAATTTAGAAAAACATGGTTGG + Intronic
928014746 2:27645407-27645429 TTCATATGGAAGAACATGTAAGG - Intronic
928382590 2:30832505-30832527 TACAGCTCCAAGAACATGGAGGG - Intergenic
928752674 2:34488539-34488561 AAGATTTTGAAAAACATGGAAGG + Intergenic
930321618 2:49861896-49861918 TACATTTTGAGGAACATCACTGG - Intergenic
930474228 2:51859471-51859493 GTCATTTTCAACAACATGGATGG - Intergenic
931503878 2:62902533-62902555 TGCATTTTCAAAAATATGGATGG + Intronic
931541852 2:63338197-63338219 TACTCTTTGAAGAACAATGAAGG - Intronic
931568394 2:63641121-63641143 GTCATTTGGAACAACATGGATGG - Intronic
931609477 2:64082970-64082992 TTCATTTGCAACAACATGGATGG - Intergenic
931682710 2:64765622-64765644 GTCATTTTCAACAACATGGATGG + Intergenic
931908954 2:66873400-66873422 TACATTTGTAAGACTATGGAAGG + Intergenic
931996299 2:67842345-67842367 TACATCTTGAAGGACAGGAAGGG - Intergenic
932131100 2:69187887-69187909 TACACTTTGAAATACATGGTAGG - Intronic
932647463 2:73518268-73518290 TGTCTTTTGCAGAACATGGATGG - Intronic
932937603 2:76123659-76123681 TAGATTTTGAAGACAATGTATGG + Intergenic
933919478 2:87030238-87030260 TGCATTTGCAGGAACATGGATGG - Intergenic
934003516 2:87739669-87739691 TGCATTTGCAGGAACATGGATGG + Intergenic
935449785 2:103196079-103196101 GTCCTTTGGAAGAACATGGATGG + Intergenic
935783679 2:106530314-106530336 TAAATTTTGAGGAACAGGGAGGG + Intergenic
935933262 2:108153009-108153031 TACATTTTGAAGGGGTTGGAAGG - Intergenic
936925851 2:117736058-117736080 TACATCTAAAAGGACATGGAGGG - Intergenic
938605383 2:132887395-132887417 TACATTTGCACCAACATGGATGG - Intronic
939043320 2:137219168-137219190 TCAATTTTGCAGAACATGGCAGG - Intronic
939257704 2:139765608-139765630 TACATTTTCAAGAACATTGGGGG - Intergenic
939401822 2:141704459-141704481 TTCAAATTCAAGAACATGGAGGG - Intronic
939857047 2:147371021-147371043 ATCATTTTCAACAACATGGATGG + Intergenic
940103156 2:150065470-150065492 TACATTCTGAGGAAAATGGAAGG + Intergenic
940141426 2:150495446-150495468 TCCATTTTAATTAACATGGAAGG + Intronic
940154358 2:150638240-150638262 TTCATCTTGCAGCACATGGAAGG + Intergenic
940508863 2:154587218-154587240 TACACTTTGCAGAACATTCAGGG + Intergenic
940878282 2:158920771-158920793 TAAATATTGAAGAGCATCGATGG - Intergenic
941116247 2:161475789-161475811 TAATTTTTGTAGAACATGTAAGG - Intronic
941302525 2:163821495-163821517 TTCATTTGCAACAACATGGATGG - Intergenic
941388468 2:164882093-164882115 AAAATTTTGAAGTACAAGGAAGG + Intergenic
942395967 2:175549954-175549976 TACATTTTTAAAAAAATTGAAGG + Intergenic
942590038 2:177533974-177533996 TACATTTAGAAGATCATTGAAGG - Intronic
943161109 2:184252481-184252503 TTCATTTGCAAAAACATGGATGG + Intergenic
943340823 2:186679472-186679494 TACTTTCTGAAGAAAATGGTGGG + Exonic
943456684 2:188117068-188117090 TACATTATGAAAAATGTGGAAGG - Intergenic
943602466 2:189938415-189938437 GTCATTTTCAACAACATGGATGG + Intronic
943966943 2:194348151-194348173 TACTTTTTGCAGAAATTGGAGGG - Intergenic
945377472 2:209096304-209096326 TGCTCTTTGCAGAACATGGATGG - Intergenic
946695228 2:222350202-222350224 AACATTTTGAAGAAAATTGATGG - Intergenic
946706000 2:222459457-222459479 CACATTTTAAAGAACAAGGAAGG + Intronic
946815076 2:223568447-223568469 TAAATTTAGAAGAATATGGAAGG + Intergenic
946891740 2:224283702-224283724 GAGATCTTGAAGAACATGAACGG + Intergenic
947985284 2:234442278-234442300 TACAATTAGAAGAACCTGAAAGG + Intergenic
1168831836 20:849286-849308 TACCTTTTTAAAAACCTGGATGG - Intronic
1169861172 20:10154073-10154095 TACATTTTAAAAAACATCTACGG - Intergenic
1169934032 20:10864105-10864127 TCCATTTTCAAGAACTTGGGAGG + Intergenic
1171162109 20:22936619-22936641 TGCATTTTGGAGATCAAGGAAGG - Intergenic
1171360889 20:24585620-24585642 TACATTTTGAAATATTTGGAAGG + Intronic
1172652674 20:36515210-36515232 TATATTTTGAAGATATTGGATGG + Intronic
1173196632 20:40919437-40919459 CACATGATAAAGAACATGGAGGG + Intergenic
1173557877 20:43980210-43980232 TCCATTTGCAACAACATGGATGG + Intronic
1174528857 20:51195140-51195162 AACATTTTTAAGAAAATGGCAGG - Intergenic
1174885786 20:54332617-54332639 TTCATTTGGAAGAACAAGAAAGG + Intergenic
1175405209 20:58721718-58721740 TACATTTTAAAAAATATAGATGG + Intergenic
1176737722 21:10567000-10567022 GTCATTTGGAACAACATGGATGG + Intronic
1177272046 21:18861879-18861901 TAGCTTGTGAAGAACATGGTTGG + Intergenic
1177401393 21:20610303-20610325 GCCATTTTCAACAACATGGATGG + Intergenic
1178036699 21:28591852-28591874 TACCTTTGCAGGAACATGGATGG - Intergenic
1178192499 21:30300783-30300805 TATATTTTCAAGTACATGTATGG + Intergenic
1179329837 21:40389018-40389040 TACATGTTGAATTACATTGAGGG - Intronic
1179340324 21:40501953-40501975 TATATCTTGAAGAACTTAGAAGG + Intronic
1180593301 22:16958197-16958219 GCCATTTGGGAGAACATGGAAGG + Intergenic
1184012373 22:41758844-41758866 TACATTTTTAAAATCATGGCTGG + Intronic
1184027876 22:41871372-41871394 TCCAAGGTGAAGAACATGGAAGG + Intronic
1184252010 22:43266155-43266177 TATATTTTCCAGAACAAGGAGGG + Intronic
1184353780 22:43964468-43964490 TTCATTTTGATGGACTTGGAAGG + Exonic
949156445 3:832383-832405 GTCATTTGGAACAACATGGATGG + Intergenic
949667712 3:6359671-6359693 TAAATTTTGAAGAACATACTCGG + Intergenic
950796943 3:15517841-15517863 TTCATTATGATGAACATGAATGG - Intronic
951069864 3:18314760-18314782 TTCATTTGCAATAACATGGATGG - Intronic
951279198 3:20726494-20726516 GTCATTTTCAATAACATGGATGG - Intergenic
951380246 3:21975246-21975268 GTCATTTACAAGAACATGGATGG + Intronic
951728494 3:25784504-25784526 TACACTTTCAAGAACATGGTGGG - Intronic
951973324 3:28473716-28473738 TTCATTTGCAACAACATGGATGG + Intronic
953507092 3:43496866-43496888 TACATCTTGAGGAACCAGGAAGG - Intronic
953587453 3:44216719-44216741 TTCATTTGCAACAACATGGATGG + Intergenic
953587670 3:44219343-44219365 TTCCTTTGCAAGAACATGGATGG - Intergenic
953886942 3:46719399-46719421 CACATTTGGAAGAAGAGGGAGGG + Intronic
956180378 3:66512306-66512328 TTAATTTTGAAGAACATTCACGG + Intergenic
957826993 3:85460455-85460477 TACATTTTGAAATGCAAGGAAGG - Intronic
957859720 3:85930759-85930781 GTCATTTTTAACAACATGGATGG - Intronic
958727075 3:97919076-97919098 TAGATTTTGGAGAAAATGAAAGG + Intronic
959020074 3:101179220-101179242 TACTTCTAGAAGAACATCGATGG + Intergenic
959171842 3:102853532-102853554 TACATTTGCAATGACATGGATGG + Intergenic
959243810 3:103836578-103836600 TACATTTACAACAACATGGATGG + Intergenic
959280428 3:104330766-104330788 GTCATTTTCAACAACATGGATGG + Intergenic
959301741 3:104611141-104611163 TACATTTTAAAGAAAGTGTAAGG - Intergenic
959435669 3:106312250-106312272 GTCATTTTCAATAACATGGATGG - Intergenic
959492624 3:107009095-107009117 TAAATATTGAAAAACCTGGAAGG + Intergenic
959682444 3:109111177-109111199 GACATTTTAAAGAACATACATGG + Intronic
959831173 3:110864412-110864434 AAGATTTTGGAGAATATGGAGGG + Intergenic
960151784 3:114256571-114256593 GTCATTTGCAAGAACATGGATGG - Intergenic
960225954 3:115168829-115168851 TAAATTTTAATGAAGATGGATGG + Intergenic
960368361 3:116803206-116803228 TACCTTGGAAAGAACATGGAAGG + Intronic
960540913 3:118861517-118861539 GTCATTTTTAACAACATGGATGG - Intergenic
961111912 3:124291569-124291591 TAGATTGTGAGGAACATGTAAGG + Intronic
961707409 3:128798149-128798171 TAAGATTTGAAGAACAGGGAAGG - Intronic
961847207 3:129775809-129775831 TACAGTATGGAGCACATGGAGGG - Intronic
962107386 3:132405635-132405657 TAAATTTTGAAGATCATAAAAGG - Intergenic
963224916 3:142852629-142852651 CACATTTTGATCAGCATGGAAGG - Intronic
963992590 3:151670443-151670465 CACATTTTGAAGACCATGAAGGG - Intergenic
964315600 3:155440847-155440869 TACATTTTTAAAAGCATAGAAGG - Intronic
964990143 3:162800794-162800816 TGCATTTGCAACAACATGGATGG + Intergenic
965575280 3:170211530-170211552 TATATTCTGAAGAACAGAGAGGG + Intergenic
965993851 3:174854218-174854240 TATCTTTTGCAGTACATGGATGG + Intronic
966336222 3:178871370-178871392 TGCATTTTGATGACAATGGAGGG - Intergenic
966490549 3:180523569-180523591 TGAATTTTTAAGAACATGGCAGG - Intergenic
966619546 3:181948881-181948903 TTCATTTTAAAAAACATTGATGG + Intergenic
967122775 3:186398132-186398154 GTCATTTGCAAGAACATGGATGG - Intergenic
967141231 3:186562372-186562394 GCCATTTTCAACAACATGGATGG + Intronic
968339035 3:197939359-197939381 TAGACTTTGAGGATCATGGAGGG + Intronic
970148894 4:13068472-13068494 TTCATTTTTAAGCACATGGGTGG + Intergenic
970795169 4:19903862-19903884 TACATTTTGATGATCTTGAATGG + Intergenic
970825232 4:20264483-20264505 TACGTTTTGAATTAGATGGAAGG + Intronic
971399672 4:26264468-26264490 TCCATTTTAAAGAAAATGGAAGG - Intronic
972144982 4:36012584-36012606 TACATTTTGAAGAACATGGATGG - Intronic
974267714 4:59606559-59606581 TTCATTTTCAACAACATGAATGG + Intergenic
974287555 4:59889176-59889198 TTGATTTAAAAGAACATGGAAGG + Intergenic
974960037 4:68687166-68687188 TTCATTTTCAACAACATGGATGG + Intergenic
976384472 4:84439664-84439686 TCTATGTTGAAGAACAAGGAGGG + Intergenic
976485106 4:85592792-85592814 TTCATTTGGAACAACATGGATGG - Intronic
976574057 4:86648530-86648552 TTCATTTGCAACAACATGGATGG - Intronic
976726680 4:88222229-88222251 TACATTTTGGAGGAAATGTATGG + Intronic
976913829 4:90344191-90344213 TTCATCTGGAACAACATGGATGG - Intronic
978129873 4:105182974-105182996 TCCATTTTGAAGAAATTGTAAGG + Intronic
978192611 4:105932421-105932443 TACATTTTTAAGAAAATTAAAGG + Intronic
978247275 4:106589134-106589156 TACATGTTGAAGAACAGACATGG + Intergenic
978336836 4:107678539-107678561 TACCTTTAGCAGAACATGGGAGG + Intronic
978378170 4:108097275-108097297 TGCATTTGCAACAACATGGATGG + Intronic
979393469 4:120156342-120156364 TCCAGTTTGAAGAAAATGTAAGG + Intergenic
980282758 4:130741797-130741819 TATCCTTTGGAGAACATGGATGG - Intergenic
980417273 4:132507860-132507882 TACATTTCTGAGAACATGGCTGG - Intergenic
980684478 4:136208653-136208675 TACATTTTGAACATCAGGAAAGG + Intergenic
980769878 4:137357094-137357116 GCCATTTTCAACAACATGGATGG + Intergenic
980837823 4:138218691-138218713 GACATTTTAAGGAACATGTAAGG + Intronic
982140451 4:152312591-152312613 TTCATAATGATGAACATGGATGG + Intergenic
982231928 4:153216770-153216792 TACATTGTGAAGGGGATGGAAGG + Intronic
982826804 4:160012333-160012355 GTCATTTTCAACAACATGGATGG + Intergenic
983735163 4:171049104-171049126 TACGTATTGAAGAACCTAGATGG - Intergenic
984484276 4:180347168-180347190 TACTTTTTTAAGAAAATAGAAGG - Intergenic
984588820 4:181593688-181593710 TTCATTTTGAATTACATAGATGG + Intergenic
985377771 4:189360074-189360096 TACCTTTAGAAGAGCATGGTTGG - Intergenic
985868523 5:2535530-2535552 TACATTTTTAAAACCATAGAGGG + Intergenic
986571917 5:9174547-9174569 TGCATTCTGAAGGACATGGAAGG - Intronic
986837625 5:11657688-11657710 TACATTTTGAATAACTTCAATGG + Intronic
987224869 5:15830148-15830170 TACATTTCCAAGACCTTGGAAGG - Intronic
987689625 5:21250253-21250275 CTCATTTGCAAGAACATGGATGG - Intergenic
987726255 5:21703728-21703750 CACATTTTAAAGAACATATATGG + Intergenic
987938018 5:24494792-24494814 TACATTTTGAATATCATAAAAGG + Intronic
988126342 5:27043153-27043175 TAAACTATGCAGAACATGGACGG + Intronic
989002295 5:36773932-36773954 TGCATTTTGAAGAAAGGGGAAGG - Intergenic
989110457 5:37902163-37902185 TACAGTTTGAAGAATATGCTTGG + Intergenic
989394566 5:40940320-40940342 TACATTTTATACAACAAGGAAGG + Intronic
990259512 5:54006534-54006556 AACAGTTTGAAAAACAGGGATGG + Intronic
990367246 5:55083817-55083839 AACATTTTTAAGAACAGGAAAGG + Intergenic
990420815 5:55631228-55631250 TACATTTTTAAGAGCATAAAGGG + Intronic
990452827 5:55952562-55952584 TACATTGTTAAGAACAATGATGG + Intronic
991279053 5:64889884-64889906 TAAATTTTGAATAAGATTGATGG + Intronic
991482128 5:67091911-67091933 TACTTTTTGAAGAGTGTGGAGGG - Intronic
991948220 5:71922143-71922165 GTCATTTTGAGCAACATGGATGG + Intergenic
992113852 5:73521265-73521287 TAACTTTTCAAGAACATGAAGGG + Intergenic
993262587 5:85678875-85678897 TATATTTACAATAACATGGATGG + Intergenic
993529066 5:89003229-89003251 TCCATTTTGCAGAGGATGGATGG + Intergenic
993539415 5:89130057-89130079 AACATTTCAAAGAAGATGGATGG - Intergenic
994667843 5:102728255-102728277 TACATTTTGAAGATGGAGGAAGG + Intergenic
994877204 5:105439472-105439494 TGCATTTGCAACAACATGGATGG + Intergenic
995172112 5:109126891-109126913 TACATTTTGATGAGCACTGAGGG + Intronic
996319387 5:122197490-122197512 TACATTGTGGAGAACATAAAAGG + Intergenic
996462155 5:123758268-123758290 GACATTTGCAACAACATGGATGG - Intergenic
996961123 5:129251280-129251302 GTCATTTTCAACAACATGGATGG - Intergenic
997058388 5:130471586-130471608 TAAATTTTGAAGACCCTGGGGGG - Intergenic
997713482 5:136025605-136025627 TACATTTTGTGGCACATGAAAGG - Intergenic
998604717 5:143621948-143621970 TGTCTTTTGCAGAACATGGATGG + Intergenic
998925046 5:147113829-147113851 TACATTTGGATGAACAAGGATGG - Intergenic
999037945 5:148374645-148374667 GACATTTGTAACAACATGGATGG - Intergenic
1000227589 5:159280766-159280788 TAAGGTTTGAAGTACATGGAAGG + Intronic
1000987089 5:167872979-167873001 TGCATGTTGAAGAACAAGGATGG - Intronic
1002017616 5:176337782-176337804 TACATCTTGCAGAAGATGTAAGG + Intronic
1003144983 6:3502621-3502643 AACATTTTTAAGAACAGGAAAGG - Intergenic
1003476686 6:6490209-6490231 CACATTTTGAGTAATATGGATGG + Intergenic
1004774321 6:18825724-18825746 TACATCTTTCAGAAAATGGAGGG - Intergenic
1007147932 6:39656088-39656110 AACATTTTAAAAAACATGAATGG - Intronic
1008550550 6:52625640-52625662 GTCCTTTTCAAGAACATGGATGG + Intergenic
1010330611 6:74619110-74619132 TACATTTAGAAGAACACCTAGGG + Intergenic
1010393147 6:75359568-75359590 CACATAATGAAGAATATGGAAGG + Intronic
1010561339 6:77355036-77355058 TTCATTTGCAACAACATGGAAGG + Intergenic
1011000879 6:82587534-82587556 TACATTTTGAAGAAGATTTCTGG - Intergenic
1011174901 6:84549593-84549615 GTCATTTTCAACAACATGGATGG - Intergenic
1011182216 6:84633757-84633779 AACATTTGAAAGAAGATGGAAGG + Intergenic
1011412814 6:87083683-87083705 TACATTTTAAGAAACATGAAAGG - Intergenic
1011790317 6:90891746-90891768 TACATTTTGACGAAAATGAAAGG - Intergenic
1012606025 6:101158280-101158302 TTTATTTTCAACAACATGGATGG + Intergenic
1012741421 6:103020419-103020441 TAAATATTAAAGAACATGGGAGG + Intergenic
1014403469 6:121019709-121019731 TACATTGTGTAGAAAATAGAGGG + Intergenic
1014717035 6:124878835-124878857 GTCATTTTCAACAACATGGATGG + Intergenic
1014971018 6:127815317-127815339 TTCATTTTCAAAAGCATGGAAGG - Intronic
1015366048 6:132399706-132399728 TCCCTTTTGTAGAACATGCAAGG + Intronic
1015768098 6:136740037-136740059 AATAATTTGAAGAACATGCAGGG - Intronic
1016288532 6:142501950-142501972 TTCCTTTGCAAGAACATGGATGG - Intergenic
1017508987 6:155095351-155095373 TTCATTGTGAAGAACTTGGCTGG + Intronic
1017579437 6:155846645-155846667 GACATTTGCAACAACATGGATGG + Intergenic
1017588991 6:155958490-155958512 TACATATTAAAAAATATGGAAGG - Intergenic
1018152522 6:160953852-160953874 TCCACTCTGAAGAAAATGGAGGG - Intergenic
1018865243 6:167742136-167742158 TCCATTTTAGAGAACATGGTGGG - Intergenic
1019353551 7:567120-567142 AACATTCTGGAGAACATGGATGG + Intronic
1019830900 7:3329185-3329207 TACATTTTGCAGATAATGGTTGG + Intronic
1020820316 7:12958796-12958818 TATATTTTCAGGAACTTGGATGG - Intergenic
1021098227 7:16557641-16557663 TACATTTTGAATAAGATATATGG - Intronic
1021294131 7:18882860-18882882 TCCTGTTTGAAGAAAATGGAAGG + Intronic
1021374791 7:19893100-19893122 TAAATTTTAAAGTAAATGGAAGG - Intergenic
1022084424 7:27052724-27052746 TACTTTTTTTAGAAAATGGAAGG + Intergenic
1022431708 7:30329608-30329630 GTCATTTTCAACAACATGGATGG - Intronic
1022559566 7:31335141-31335163 TATAGTATAAAGAACATGGAAGG - Intergenic
1022675374 7:32495014-32495036 TACATATTTAAGAATAAGGACGG + Intronic
1022778414 7:33552772-33552794 TAAATTTTGAAATAAATGGATGG - Intronic
1022787225 7:33650644-33650666 TACATGTAGATCAACATGGAAGG + Intergenic
1023078711 7:36507830-36507852 TACACTTTGAAGCTCTTGGATGG - Intergenic
1023561511 7:41478144-41478166 AGCATTTTGAAGAAAATCGATGG + Intergenic
1023645627 7:42311222-42311244 AAAATTTTTAGGAACATGGATGG + Intergenic
1024381097 7:48697072-48697094 TACATTTTAATGAACATGACAGG + Intergenic
1024899300 7:54299451-54299473 AACAATTTGTAAAACATGGAGGG - Intergenic
1026633424 7:72059185-72059207 CAGATTTTGAAGACCATAGATGG - Intronic
1027477917 7:78656376-78656398 TGCATTTGCAACAACATGGATGG + Intronic
1028033180 7:85944584-85944606 GACATTTGCAACAACATGGATGG - Intergenic
1028344660 7:89764236-89764258 TACAATTTCAACAACATTGAAGG + Intergenic
1028929087 7:96392846-96392868 GTCATTTTCAACAACATGGATGG - Intergenic
1029100757 7:98128225-98128247 TATAGTTTGAGGTACATGGAGGG - Intronic
1029439671 7:100580040-100580062 TTGGTTTTGAAGAACAAGGAGGG - Intronic
1031181482 7:118422909-118422931 TGCATTATGTAGAAAATGGAAGG + Intergenic
1033050834 7:138002418-138002440 TACATTTTGTAAAAGAGGGAGGG + Intronic
1033068361 7:138177837-138177859 TACAATTTTAAAAACATGGATGG + Intergenic
1034857215 7:154563111-154563133 TAGCTATTGAAGGACATGGAAGG + Intronic
1035347388 7:158212052-158212074 TTCATTTGCAACAACATGGATGG + Intronic
1035898604 8:3433129-3433151 TGCATTTTGATAAACATGGTGGG + Intronic
1035955416 8:4072298-4072320 TACATTTTGAAGGCAAAGGAAGG - Intronic
1036006867 8:4674720-4674742 TACATATAGAAGAAAATGCAAGG + Intronic
1036083306 8:5582249-5582271 TATATTTTGAATAACATGAATGG + Intergenic
1037052134 8:14387500-14387522 TACAATTTGAAGATCATTGCTGG + Intronic
1037268298 8:17094010-17094032 TATCTTTTGAAGGACATTGAGGG - Intronic
1037303007 8:17472629-17472651 TAGATTTTGAAGAAATTGAAGGG - Intergenic
1037713962 8:21380970-21380992 TATATTTTGTAGAAAATGTAAGG - Intergenic
1038625933 8:29193250-29193272 TAGCTTTGGAAAAACATGGAGGG - Intronic
1038801635 8:30754608-30754630 TACATTTTTAGGAACATTAATGG + Intronic
1040348070 8:46530251-46530273 AACATTTTGAAGACCATTGAGGG + Intergenic
1040884459 8:52244672-52244694 TATATTTTGGAAAACATGTAGGG - Intronic
1040965395 8:53076696-53076718 CACATTTTGGAGACCATGAAGGG - Intergenic
1043001903 8:74769904-74769926 GACATTTTGAAAACCATGTAGGG + Intronic
1043540128 8:81252879-81252901 AACATTTGGAAGAACATGGAAGG + Intergenic
1043742787 8:83835064-83835086 TATTTTTTGAACAAAATGGATGG + Intergenic
1043742811 8:83835410-83835432 CACAATTTCAAGCACATGGAAGG - Intergenic
1044025666 8:87168734-87168756 GTCATTTTCAACAACATGGATGG - Intronic
1044246532 8:89953775-89953797 TACATTGTGAACTAAATGGAGGG - Intronic
1045286803 8:100798640-100798662 TACATATTGAAATCCATGGATGG - Intergenic
1045727407 8:105190441-105190463 GTCATTTTTAACAACATGGATGG - Intronic
1045991353 8:108312279-108312301 ATCATTTGGAATAACATGGATGG + Intronic
1047954633 8:129964572-129964594 CCCATTTTCAAGAAAATGGATGG - Intronic
1047972776 8:130099649-130099671 TACATGTTGTAGCACATGAAAGG + Intronic
1049017309 8:139929908-139929930 TCCATTTTACAGGACATGGAAGG - Intronic
1050192338 9:3040382-3040404 TGCATTTTGAAGAAGAAAGAGGG + Intergenic
1050866812 9:10511004-10511026 TACATTTACAATAACATGGATGG - Intronic
1051163906 9:14240374-14240396 TCCATTTTGAAGCATATGGCTGG + Intronic
1051840095 9:21386315-21386337 GTCATTTGCAAGAACATGGATGG + Intergenic
1051968221 9:22855652-22855674 TACAGTATGAAGAACATAGCAGG + Intergenic
1052112292 9:24601451-24601473 TTTATTTTGAAAAAAATGGAAGG + Intergenic
1054989994 9:71314342-71314364 TAAATGTTGAAGAATAAGGAAGG - Intronic
1055418596 9:76111179-76111201 TACATTCTGTAGAAAAAGGATGG - Intronic
1056652377 9:88477322-88477344 TACATTTTGAAGTATCTTGAGGG + Exonic
1056966947 9:91170958-91170980 GACATTTTTAAGAAGTTGGAGGG - Intergenic
1058286952 9:103190248-103190270 TACAGTTACAAGAACGTGGAGGG + Intergenic
1059931649 9:119266801-119266823 TTCATTTGCAACAACATGGATGG - Intronic
1060563952 9:124572370-124572392 GACAACTTCAAGAACATGGAGGG + Intronic
1060708138 9:125826339-125826361 AACATTTTGAAGAGAAAGGAAGG - Intronic
1062181673 9:135194313-135194335 TACATTTGGGATAACAAGGAAGG - Intergenic
1062349173 9:136130803-136130825 TGAATTTTGAAGGACATGAAAGG - Intergenic
1185953209 X:4459243-4459265 TACATTTGAAAGAATTTGGAAGG + Intergenic
1187015397 X:15322316-15322338 TACATGTTGCTGAGCATGGATGG + Intronic
1187077591 X:15950984-15951006 TACATTTTGAAGTAGAGAGAGGG - Intergenic
1187137801 X:16565197-16565219 TATCTTTTCAAGAACATGGTGGG + Intergenic
1188104794 X:26137081-26137103 GCCCTTTTCAAGAACATGGATGG + Intergenic
1188151050 X:26675875-26675897 AACATGTAGAGGAACATGGAGGG + Intergenic
1188417120 X:29949088-29949110 GTCATTTTAAAGAACATTGAGGG + Intronic
1188827901 X:34858938-34858960 TACATTTTGTAGACCAAGAAAGG - Intergenic
1188972089 X:36630212-36630234 AACATTTGCAACAACATGGATGG - Intergenic
1189639928 X:43057495-43057517 TACATTTTCAAAACTATGGAAGG - Intergenic
1189794786 X:44635317-44635339 TACAGTCTGAAGAACATAGCTGG + Intergenic
1191030890 X:55969528-55969550 TGCATCTTGAAGAACTAGGAGGG + Intergenic
1191701371 X:64046184-64046206 GTCATTTTTAATAACATGGATGG + Intergenic
1191710698 X:64147588-64147610 TTCCTTTGCAAGAACATGGATGG - Intergenic
1192068084 X:67907812-67907834 GTCATTTGCAAGAACATGGATGG + Intergenic
1193012191 X:76688432-76688454 GATATTTTGAAAAACATGGCAGG - Intergenic
1193226246 X:78987650-78987672 TTCATTTTGATGGAGATGGAAGG - Intergenic
1193396277 X:80987648-80987670 TACATTTTCAAGAACTAGGTAGG + Intergenic
1193781680 X:85710708-85710730 TTCATTTGCAACAACATGGATGG + Intergenic
1194051550 X:89075382-89075404 TACAGTTCCAAGAATATGGAGGG + Intergenic
1194171959 X:90597777-90597799 TAAATTGTGAAGAAAATGGATGG - Intergenic
1194371400 X:93077570-93077592 CTCATTTGGAACAACATGGATGG + Intergenic
1194834670 X:98667546-98667568 TACATTTTAAAGAACTAGAAAGG - Intergenic
1196079426 X:111615643-111615665 TTCAATTTGAAGAACAGGAATGG - Intergenic
1196264255 X:113623334-113623356 GTCATTTTTAATAACATGGATGG - Intergenic
1196486568 X:116217303-116217325 TGTCTTTTGCAGAACATGGATGG + Intergenic
1196758976 X:119182585-119182607 TACATTTTGAATAAGCTTGATGG - Intergenic
1197180322 X:123528624-123528646 GTCATTTTCAACAACATGGATGG - Intergenic
1197286255 X:124598577-124598599 GTCATTTGCAAGAACATGGAGGG + Intronic
1197402018 X:126004873-126004895 ATCATTTTCAACAACATGGATGG - Intergenic
1197672658 X:129295669-129295691 GTCATTTTCAACAACATGGATGG + Intergenic
1197833347 X:130668941-130668963 TACATTTTGAAAAACTGGAAAGG - Intronic
1198009924 X:132541526-132541548 GTCATTTGCAAGAACATGGATGG - Intergenic
1198809481 X:140520993-140521015 TAAATTGTGGAGAACATTGAAGG + Intergenic
1199034704 X:143036061-143036083 GGCATTTTCCAGAACATGGATGG - Intergenic
1199108439 X:143900803-143900825 TTCATTTGAAACAACATGGATGG + Intergenic
1199367878 X:147008338-147008360 ATCATTTGGAACAACATGGATGG - Intergenic
1199486525 X:148354289-148354311 ATCATTTTCAACAACATGGAAGG + Intergenic
1199925487 X:152458654-152458676 AACATTTGGAAAAACATTGAAGG + Intergenic
1200330923 X:155297149-155297171 GTCATTTGGAACAACATGGATGG + Intronic
1200518189 Y:4175526-4175548 TAAATTGTGAAGAACATGGATGG - Intergenic
1200679197 Y:6189448-6189470 CTCATTTGGAACAACATGGATGG + Intergenic
1201689173 Y:16743927-16743949 GCCATTTTCAACAACATGGATGG - Intergenic