ID: 972149318

View in Genome Browser
Species Human (GRCh38)
Location 4:36068812-36068834
Sequence TTTTATGTATGTTCACCTTA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 307
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 284}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972149316_972149318 9 Left 972149316 4:36068780-36068802 CCATAGGTTAGGTGTATTTAACG 0: 1
1: 0
2: 7
3: 9
4: 66
Right 972149318 4:36068812-36068834 TTTTATGTATGTTCACCTTATGG 0: 1
1: 0
2: 2
3: 20
4: 284

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972149318 Original CRISPR TTTTATGTATGTTCACCTTA TGG Intronic
901950302 1:12739975-12739997 TTTGATGTGTTTTCACCTTCTGG - Intergenic
903073823 1:20745807-20745829 TTATATGTATGTTCAAAATACGG - Intronic
904099855 1:28015945-28015967 TTTTACATATGTTGAACTTAGGG + Intronic
905600178 1:39243157-39243179 TTTGATTTATGTTTTCCTTATGG + Intronic
907104025 1:51864165-51864187 ATTTATGTTGGTTCAACTTAGGG - Intronic
907751573 1:57268342-57268364 TTTTCTGTTTGTTAACCTTATGG + Intronic
907803263 1:57792776-57792798 TTTTATTTATGTACCCCATAGGG + Intronic
909346773 1:74598725-74598747 TCTTATTTATGTTAATCTTATGG - Intronic
912168367 1:107067524-107067546 TCTTATTTATGTTAATCTTATGG + Intergenic
912472943 1:109918209-109918231 TTTCCTGTTTGTTTACCTTAGGG - Intronic
912820783 1:112866057-112866079 TTTTATGTTTCCTCACCTGAAGG + Intergenic
912972867 1:114300386-114300408 TTTTCTGGATGTCTACCTTAGGG - Intergenic
913375765 1:118150391-118150413 TTTTGTGTGTGTTCACCATCAGG + Intronic
915423436 1:155804069-155804091 TTTTATGTATGATTTCATTAGGG - Intronic
916314331 1:163431860-163431882 TTTTATTTTTGGTCACTTTAAGG + Intergenic
916370413 1:164087968-164087990 ATGTATGTATGTCCTCCTTATGG + Intergenic
918595521 1:186288438-186288460 TTTCATTTATCTTCTCCTTAAGG + Intergenic
918810987 1:189120435-189120457 TTTGAAATATGTACACCTTACGG - Intergenic
918865619 1:189895196-189895218 TTTTATTTATGTTAATCTTTGGG + Intergenic
921197195 1:212769652-212769674 TTTTATGTGTTTTCACATGATGG - Intronic
921759231 1:218893260-218893282 TTAAATGTATTTTCAACTTATGG - Intergenic
921901827 1:220459158-220459180 TTTTATGTATGTTTGCCCTGGGG + Intergenic
921964224 1:221070948-221070970 TTTAATAAATGTTAACCTTATGG + Intergenic
922135364 1:222819989-222820011 TTTCATTTATGTTCACCAAAAGG + Intergenic
1062999617 10:1903580-1903602 TTTTGTGTATGTTAACATTTTGG + Intergenic
1065062026 10:21911984-21912006 TTTAATGTATTTGCAACTTAGGG + Intronic
1066071042 10:31813187-31813209 TTTTATGTATTTTTACTTTTTGG - Intronic
1066093211 10:32046875-32046897 TTTGATGCATTTTCAGCTTAGGG - Intronic
1069165658 10:65155160-65155182 TTTAAAGTATGTTTACATTATGG - Intergenic
1070106885 10:73441778-73441800 TTTTATGTATGTTTTCTTTCTGG - Intronic
1073497170 10:103903234-103903256 TTTTCTGTTTGTGCACCCTATGG - Intronic
1073643547 10:105276775-105276797 CTTTATTTATGTTCATCTAATGG + Intergenic
1073917308 10:108420528-108420550 TTTCATTTATGTTCACTTTTTGG + Intergenic
1074251171 10:111749716-111749738 TTTTATATATGTTTACATTGTGG + Intergenic
1074313332 10:112341189-112341211 TTTACTGTGTGTTCTCCTTAGGG + Intergenic
1074417604 10:113280883-113280905 TTAAATGTATATTCACCTAATGG - Intergenic
1075009350 10:118854325-118854347 TTTTATGAAGCTTCCCCTTATGG - Intergenic
1077622934 11:3743679-3743701 TATTATGTATTTTGAACTTAAGG - Intronic
1079778684 11:24568951-24568973 TTTTATTTATTTTTCCCTTAAGG - Intronic
1079858822 11:25641886-25641908 TTTTAGGTATGTTTCCCATAAGG - Intergenic
1080241833 11:30135695-30135717 CTTTAAGTATATTCACATTAAGG + Intergenic
1080319670 11:30992104-30992126 TTTTATTTATGTTTTTCTTAAGG - Intronic
1081029042 11:38054649-38054671 TTTTATGTATGATTTGCTTATGG - Intergenic
1082973306 11:59046432-59046454 TTTTATATTTATTCACCTTATGG + Intergenic
1083066473 11:59929307-59929329 TTTTATGTATGGCCAGCTTTGGG - Intergenic
1083118045 11:60483321-60483343 TTTGATATATGTACACCTTGTGG - Intergenic
1086196874 11:84151029-84151051 TTGTATCTATGTTCACATCAGGG + Intronic
1089166289 11:116479279-116479301 TTTTAAGTAAGTGCTCCTTAAGG + Intergenic
1090683823 11:129092689-129092711 TTTTAGTTGTGGTCACCTTAAGG - Intronic
1090708199 11:129359232-129359254 TTTGATGTATGTGTACATTATGG + Intergenic
1090740566 11:129655988-129656010 TTTTATGTGTGATCACATGATGG - Intergenic
1091734590 12:2909444-2909466 TTTTATGTATGTACTCTTTTGGG - Intronic
1091984428 12:4896922-4896944 TTTTATGTGTGTCCTTCTTAAGG + Intergenic
1093283580 12:17228399-17228421 TGTTATTTTTGTTTACCTTATGG - Intergenic
1093922580 12:24875918-24875940 TTAAATGCATTTTCACCTTAAGG - Intronic
1094885660 12:34867609-34867631 TTTTGTGTGTGTTCAACTCAAGG + Intergenic
1095687600 12:45052532-45052554 TTCTTTTTAAGTTCACCTTATGG + Intergenic
1097593121 12:61595513-61595535 TTTTATGTATTTTAATTTTAAGG - Intergenic
1097682966 12:62666665-62666687 TTGTATCTACGTTCAACTTAAGG + Intronic
1097685355 12:62685836-62685858 TTTGATATATGTTTACATTATGG - Intronic
1098310240 12:69141114-69141136 CTTTATGCATGTTTACATTAAGG + Intergenic
1098948423 12:76613960-76613982 ATTTATGCATGTGCACCTTGGGG + Intergenic
1099205478 12:79721593-79721615 GATTATGTTTGTTGACCTTAAGG - Intergenic
1099210816 12:79785998-79786020 TTTTATGTTTGTTCAAGTAAAGG - Intronic
1099599080 12:84708771-84708793 TTTTATGTATATTAACATTAGGG + Intergenic
1101623318 12:106412492-106412514 TTTTATGGCTTTTCACCTAAGGG - Intronic
1102123002 12:110457711-110457733 TTTTATTTTTGTCCATCTTATGG - Intronic
1107736990 13:43409470-43409492 TTTAATGTATGCTTACCATATGG + Intronic
1107912577 13:45119274-45119296 TTTTATGTGTGTTCAGCATAGGG - Intergenic
1108337346 13:49458592-49458614 TATTCTGTATGTTCTCCCTATGG + Intronic
1108890163 13:55247663-55247685 TTTTATTTTTGTTCAACATATGG - Intergenic
1109073400 13:57800365-57800387 TCTTAAGTAAGTTCAACTTAAGG + Intergenic
1109351215 13:61184121-61184143 TTTTAAGTATGTGTACCTAAAGG - Intergenic
1109582290 13:64357052-64357074 ATTTATGTTTTTTCACCTCATGG + Intergenic
1109624650 13:64958859-64958881 TTTTATGTATGTACATGTAATGG + Intergenic
1110284085 13:73729801-73729823 TTTTCTGTAAGTTCACCATAGGG + Intronic
1110384209 13:74889859-74889881 TATTATTTATGTTAACTTTAAGG + Intergenic
1110398284 13:75058538-75058560 TTTTGTGTGTGTTTACCTTTTGG - Intergenic
1110908177 13:80919011-80919033 TCTTATTTATTTTCACCTTATGG - Intergenic
1116208302 14:41898474-41898496 GTTTAACTATGTTCACCATATGG - Intronic
1116228821 14:42188881-42188903 TTTGATATATGTTTACATTATGG + Intergenic
1117524798 14:56588712-56588734 ATTTATGTATTGTCCCCTTAAGG + Intronic
1117984275 14:61372277-61372299 TTTTAGGTCTGTTCAGCTGACGG + Intronic
1118910497 14:70058337-70058359 TTTTATGACCTTTCACCTTATGG + Intronic
1120316843 14:82905235-82905257 TTTAATGTCTTTTTACCTTAAGG + Intergenic
1121158287 14:91708574-91708596 TTTTTTTGTTGTTCACCTTAGGG - Intronic
1121811839 14:96898232-96898254 TTCTATGTATGTGAAGCTTAGGG + Intronic
1121988539 14:98531562-98531584 TTTTCTTTCTGTTCACCTCAGGG - Intergenic
1123675489 15:22707241-22707263 ATTTGTGTATGTTCACTTAAGGG + Intergenic
1124563566 15:30795924-30795946 TTTTCTGTATGTTCAACCTCTGG - Intergenic
1124674572 15:31673083-31673105 CTTAATGTATTTTCAACTTAAGG - Intronic
1126251811 15:46576016-46576038 TTTTCTGTCTTTTGACCTTAGGG + Intergenic
1126496855 15:49301117-49301139 TTTTAAGGATGTTAACCTTGAGG + Intronic
1127061743 15:55193683-55193705 TTTTATATATGTTGCCCTAAGGG + Intronic
1128193723 15:65730119-65730141 TTTAATGTGTATTTACCTTAAGG - Intronic
1132417771 15:101636061-101636083 TTTGAGGTTTATTCACCTTATGG + Intronic
1134037074 16:11039402-11039424 ATTTATGTAAGTTCAGTTTATGG + Intronic
1134407210 16:13971006-13971028 GTTTATGTATGTTCAACTTCAGG + Intergenic
1135074568 16:19382396-19382418 TTTTGTGTTTGTTCTCCTTGTGG - Intergenic
1135606254 16:23827688-23827710 TTTTCTGTATGTTGACCTGGTGG + Intergenic
1137021924 16:35436566-35436588 GTTTATGTATGTTCATCTTTAGG - Intergenic
1137651966 16:50128263-50128285 TTTGATATATGTACACATTATGG + Intergenic
1139066429 16:63321076-63321098 TTTTATGTATTTACACATTGTGG + Intergenic
1139096034 16:63705501-63705523 TTCTCTGTATGTTCTGCTTAAGG - Intergenic
1139262900 16:65612190-65612212 TATTATGTATCTTCATCTCAAGG + Intergenic
1139325217 16:66147466-66147488 TTTTATGTATGTCCCACATATGG - Intergenic
1142069264 16:88081549-88081571 TTTTTTGTATGTTGGCCTTGTGG - Intronic
1144261273 17:13523931-13523953 TTTTATGTATTTTAATATTAAGG - Intronic
1146898587 17:36564986-36565008 TGTTATGTAAGATCACCTAAAGG + Intronic
1148261672 17:46189477-46189499 TTTTATGTTTTTTCAGCTTGTGG - Intronic
1150769032 17:68025793-68025815 TTATATGGATGTTCACCCAAAGG + Intergenic
1154099744 18:11460763-11460785 TTTAATGTGTGTTTACCTGAAGG + Intergenic
1155653011 18:28163113-28163135 TTCTATGTATTTTGACCTTTTGG - Intronic
1155685385 18:28542067-28542089 TTTCATGTATTTTCCCCTTCTGG - Intergenic
1156917381 18:42477628-42477650 ATGTATGTATCTTCACATTAGGG - Intergenic
1158192510 18:54846159-54846181 ATCTATGTATCTTCTCCTTAAGG - Intronic
1158287069 18:55895690-55895712 CTTTATATATGTTTACATTATGG - Intergenic
1158467749 18:57706319-57706341 TTTTATTGATGTTTACCTTTGGG - Intronic
1158933462 18:62343491-62343513 TGTTATGTTTCTTCAGCTTATGG + Intronic
1159826486 18:73219200-73219222 TTTTATTTGTGCTCAGCTTAGGG - Intronic
1159827743 18:73235565-73235587 TTTTATGGCTGTTCACCATTTGG - Intronic
1159981606 18:74788151-74788173 TTTTATTTATTTTTTCCTTATGG + Intronic
1164492649 19:28728673-28728695 TGTTTTGTGTTTTCACCTTATGG - Intergenic
1167718686 19:51162153-51162175 TGTAATCCATGTTCACCTTAGGG + Intergenic
925776564 2:7341230-7341252 TCTTATGTTTGTGGACCTTATGG - Intergenic
925866427 2:8231837-8231859 TATTATGTGTGTTCACATTTAGG - Intergenic
929250909 2:39754023-39754045 TTTTATGTATTTTCACTTTAGGG - Intronic
929289586 2:40174296-40174318 TTTTATGTATTTTCTCAATATGG + Intronic
933127655 2:78630841-78630863 TATTAACCATGTTCACCTTACGG + Intergenic
933882629 2:86685706-86685728 TGTTAGGTATGTACACATTAAGG + Intronic
934977544 2:98815337-98815359 TTTTATGCATGTGCAGCTCAGGG + Intronic
935347229 2:102119716-102119738 TTTGTTGTATGTACACATTATGG + Intronic
936157304 2:110056704-110056726 GTTTATGTATGTGCACATCAAGG + Intergenic
936187390 2:110314740-110314762 GTTTATGTATGTGCACATCAAGG - Intergenic
939187764 2:138880688-138880710 TTTTATAAATGTTCCTCTTAAGG - Intergenic
939457230 2:142453074-142453096 TTTTATGTTTGTTCAGCTTTGGG - Intergenic
939848372 2:147275038-147275060 TCTTATGTGTTTTCATCTTAGGG + Intergenic
940314903 2:152318529-152318551 CTTTCTTTATGTTCACTTTAAGG + Intergenic
941732926 2:168938326-168938348 TTTTATGGATGTTTATTTTATGG - Intronic
943099750 2:183473469-183473491 TTTTGTGTTTTTTAACCTTATGG - Intergenic
944730533 2:202512429-202512451 TTTTCTGTATGCTCAACTAAAGG + Intronic
945434433 2:209802373-209802395 TTTAATATATGTTCATATTATGG - Intronic
946594886 2:221295563-221295585 TTGTATGTATGTGCACACTAGGG + Intergenic
946635269 2:221718217-221718239 TTTTATGTCTGTCCTCCTGAAGG + Intergenic
947038169 2:225884060-225884082 GTTTATGTAAGTTCACTTGATGG + Intergenic
1170636970 20:18115443-18115465 TGTTATGTGTGTACACATTAAGG + Intergenic
1170678067 20:18500560-18500582 TTTTAAATATGTGCAGCTTAAGG + Intergenic
1171022037 20:21593925-21593947 TTTTACGTCTGTACACCTAACGG - Intergenic
1172557491 20:35854869-35854891 TTTTATGTAAGTCCTCCTTCTGG + Intronic
1173762080 20:45571403-45571425 TTTGATGTATGTACACATTGCGG + Intronic
1174397290 20:50254987-50255009 TTTTTTGTATGACCACATTAGGG + Intergenic
1174947927 20:55009278-55009300 TTTTTTGTGTGTTCATTTTAGGG + Intergenic
1175526423 20:59637629-59637651 TTTCATATTTGTTCACGTTAGGG - Intronic
1177493597 21:21860859-21860881 TTTTATATATGTACTCTTTAGGG + Intergenic
1177997176 21:28115481-28115503 CATTAAGTATGTTCACCATAAGG - Intergenic
1178293843 21:31392122-31392144 TTAAATGTATTTTCAACTTAAGG + Intronic
1178664570 21:34534999-34535021 TTGGATGCATGTCCACCTTAAGG + Intronic
1178969586 21:37160689-37160711 TTTTATGTACATTTAACTTATGG + Intronic
1182731023 22:32493672-32493694 ATTTCTGTATGGTCACATTATGG + Intronic
1185198443 22:49487457-49487479 TTTTATGTATTTTCTGCTTGGGG + Intronic
949718545 3:6961829-6961851 TTTTCTGTATGCTCAGCATATGG + Intronic
950367294 3:12496457-12496479 TTTAGTGTTTGTTCCCCTTATGG + Intronic
951187068 3:19725744-19725766 TTATTTCTATGTTCAACTTATGG - Intergenic
951393193 3:22131967-22131989 TATTAAGTATGTTCACCTGTAGG + Intronic
958156700 3:89763696-89763718 TTTTGTTTATGTTTACCTGAAGG + Intergenic
958502476 3:94931348-94931370 TTGTATGTATGTAGACATTATGG + Intergenic
959245748 3:103865424-103865446 TTTTATGGAGGTTCACTTTATGG - Intergenic
959538841 3:107517807-107517829 TTTTATCTATGTTATTCTTAAGG - Intergenic
962556093 3:136553321-136553343 TTTTATTTATCTTCTCCTTCAGG - Intronic
963360262 3:144263580-144263602 TTTTATTTATTTTCTCCTTTGGG + Intergenic
963969198 3:151410588-151410610 CTTTGTGTATTGTCACCTTATGG - Intronic
964275192 3:155001911-155001933 TTTTATGTATTTTATACTTATGG - Intergenic
964565574 3:158048011-158048033 TTTTATATATGTTTACATTATGG - Intergenic
966699433 3:182830387-182830409 TTTTATGTATTTTCCCCCTGGGG + Intronic
971316740 4:25573975-25573997 ATTCATGGATTTTCACCTTAGGG + Intergenic
972149318 4:36068812-36068834 TTTTATGTATGTTCACCTTATGG + Intronic
972948500 4:44288035-44288057 TTTAATGTCTGTTCAACTAAAGG - Intronic
975881861 4:78919318-78919340 TTTTATGAATGTCTACTTTAAGG + Exonic
976862976 4:89688783-89688805 TTTTATATATGTTCACTTTCTGG - Intergenic
977007136 4:91582011-91582033 GTTTATGTATATGCACCTCAAGG + Intronic
978407635 4:108396822-108396844 TTTTATAGATGTTGACCTGAGGG + Intergenic
979363566 4:119793427-119793449 TTTAATGTATGTTTAACTTTTGG + Intergenic
979793949 4:124820471-124820493 TTTTATGTGTGTTGGCCTTTTGG + Intergenic
981233353 4:142385830-142385852 TTTGATATATGTTCACATTGTGG + Intronic
981620378 4:146690732-146690754 TTTGATGTATGTATACCTTGTGG - Intergenic
981785834 4:148478675-148478697 TTTTATAAATGTGCAACTTATGG + Intergenic
982505809 4:156216430-156216452 TTTTATGCATGTTTACATTTGGG - Intergenic
983075778 4:163324731-163324753 TTTTTTTTTTTTTCACCTTAAGG - Exonic
983443672 4:167820891-167820913 CCTTATGGATTTTCACCTTATGG + Intergenic
983617846 4:169727513-169727535 TTTTAAGTGTGTTAACATTAGGG + Intergenic
984691992 4:182736930-182736952 TTTAATGAAGGTTCATCTTATGG + Exonic
984980240 4:185273446-185273468 TTTGATGTATGTACACATTGTGG + Intronic
985161570 4:187050205-187050227 TTTGATGTCTGTACTCCTTAGGG - Intergenic
986017621 5:3771458-3771480 TTTTATTTTTGTTCACTTAAAGG - Intergenic
986185497 5:5432439-5432461 TTTAATTTATGTTCACTTTTTGG + Intronic
986396029 5:7331679-7331701 TCTGATGTATGTTCATATTAAGG + Intergenic
986942067 5:12965817-12965839 TTCTATCTATGAACACCTTAGGG - Intergenic
987781187 5:22437474-22437496 TTTAATGTATTCTCACTTTATGG - Intronic
989082054 5:37633294-37633316 TTTTATATCTGTTTCCCTTAAGG + Intronic
989336294 5:40320659-40320681 TTTCTTGTATGTTCAACTCATGG - Intergenic
991163740 5:63536708-63536730 TTTTATGTAAGTTAAATTTATGG - Intergenic
991483463 5:67108969-67108991 TTCTCTGTATGTTCACTTTTAGG - Intronic
992117930 5:73560226-73560248 TTTAATATATGTTTACATTATGG + Intronic
992588493 5:78268167-78268189 TACTATAAATGTTCACCTTAAGG + Intronic
993010895 5:82481231-82481253 TTTTATCTATAATCACCTAAAGG - Intergenic
993132000 5:83910194-83910216 CTTTATGTATTGTCATCTTAAGG + Intergenic
993631311 5:90289096-90289118 TTTTTTGTATGTTCACGGGATGG + Intergenic
993770831 5:91924109-91924131 TATTATCTATATTCACCATAAGG - Intergenic
994984809 5:106918898-106918920 TTTTATGTCTAATCACATTAAGG + Intergenic
995930250 5:117432795-117432817 TATTATGTCTGTTCACATGACGG + Intergenic
996031221 5:118706009-118706031 TTTTATGTCTTTTCCCCTTGGGG - Intergenic
996507232 5:124281136-124281158 TTTGATGTATGTACACGTTATGG + Intergenic
998881617 5:146651144-146651166 TTTTATGTCTTTTCATCTCATGG + Intronic
999700552 5:154224034-154224056 TTTTCTCTCTGTTCCCCTTAAGG - Intronic
1000807753 5:165817812-165817834 TTTAATTTTTGTTCACCTCATGG + Intergenic
1001067602 5:168550317-168550339 TTAAATGTATTTTCAACTTACGG + Exonic
1001806542 5:174591494-174591516 TATTAGGTGTGTTCCCCTTATGG + Intergenic
1002038803 5:176495450-176495472 TTTTACCTATGTTTTCCTTATGG - Intronic
1002378918 5:178810897-178810919 TTATATATATGTTCACTTTTTGG - Intergenic
1003781917 6:9438643-9438665 TTTTATGTATATTAACTTAACGG + Intergenic
1004033798 6:11901579-11901601 TTTTATGTTTATTCTACTTAAGG + Intergenic
1005365994 6:25077550-25077572 TTACACGTATGTTCACTTTAGGG + Intergenic
1005682465 6:28220199-28220221 GTTTATGTATTTTTAACTTAAGG + Intergenic
1006346001 6:33483456-33483478 TTTTATTTATGGTGTCCTTATGG + Intergenic
1007802636 6:44409996-44410018 TTTGATATATGTATACCTTATGG + Intronic
1008705975 6:54159559-54159581 TTTTATAGTTTTTCACCTTACGG + Intronic
1008929726 6:56926052-56926074 TTTGATTTATGTTCACATTGTGG - Intronic
1010131766 6:72502562-72502584 TTTTATGTCTGTTTACTTTAGGG + Intergenic
1010660718 6:78567974-78567996 TTTGATGTATGTTTATATTATGG - Intergenic
1011096400 6:83669854-83669876 ATTTTTGTATGTTCATCTAATGG - Intronic
1013020773 6:106215135-106215157 TTTTATGTAAGTACACCAAAAGG - Intronic
1013728498 6:113132654-113132676 TTTTTTGTATTTGTACCTTAAGG + Intergenic
1014051096 6:116955233-116955255 ATTTATGATTCTTCACCTTAAGG - Intergenic
1014178614 6:118358251-118358273 TTTTAGGTATGTACATATTAAGG - Intergenic
1014481399 6:121942214-121942236 TTTTATTTCTGTTTACCATAGGG + Intergenic
1014994141 6:128120575-128120597 TTTTATGTATGTATTGCTTATGG + Intronic
1015500229 6:133924152-133924174 TTTTCTGTATGTTCACAATAGGG + Intergenic
1017327217 6:153153073-153153095 TTTTATGTATGTTAGCCCTTAGG + Intergenic
1019223267 6:170491691-170491713 TTGTATGTATGCTAACATTAGGG + Intergenic
1020871470 7:13635049-13635071 TTTTATGTATGGTCTCGTTGTGG - Intergenic
1021033699 7:15770495-15770517 TTTTGTGTGTGTTTACCATAAGG - Intergenic
1021296688 7:18916753-18916775 TTCTATGTATGTACACTTTTTGG - Intronic
1021640684 7:22733571-22733593 GTTTATGTATCTTCATCTTCAGG + Intergenic
1022011578 7:26312267-26312289 TTTTATGAAGGTTTTCCTTATGG - Intronic
1024724816 7:52180596-52180618 TTTTATATGTGATCACATTAAGG - Intergenic
1024815664 7:53267537-53267559 TTTTATGTATCTTTACATGATGG + Intergenic
1024843497 7:53615205-53615227 TCCTATGTATGTTCTCCTCATGG + Intergenic
1025970050 7:66314653-66314675 ATTTATGTAAGTACACCCTATGG - Intronic
1026209142 7:68287828-68287850 ATCTATGTAAGTTCACTTTAAGG - Intergenic
1026215267 7:68342887-68342909 TGTTAAGTATGTTCCCTTTAGGG + Intergenic
1026670274 7:72384195-72384217 TTTTATGTAAGTCCACATAATGG - Intronic
1027923875 7:84434581-84434603 TTTTATGTCTGTCCTCATTAGGG - Intronic
1028388603 7:90289200-90289222 TTTTACGTCTGTTCAGCTTTAGG + Intronic
1028967173 7:96815231-96815253 TTTTTTGTATGTTTATCTTCAGG + Intergenic
1029040846 7:97572595-97572617 TTTTATGTCTGTTAAACATAAGG + Intergenic
1029835269 7:103302692-103302714 TTTTAATTAAGTTCACTTTAAGG - Intronic
1030894819 7:115045584-115045606 ATTTATGTATGGTTTCCTTATGG + Intergenic
1031307946 7:120156780-120156802 TTTCAAGTATATTCACTTTAGGG - Intergenic
1032680175 7:134174282-134174304 TCTTATCCATGTTCACTTTAAGG - Intronic
1037066770 8:14589816-14589838 TTTTATGTATGTGGAAATTAAGG + Intronic
1039380391 8:37079547-37079569 TTTTATGTATGTGTGCCTTTAGG - Intergenic
1040721999 8:50335856-50335878 TTTTATTTATGTTACCCTTATGG + Intronic
1041442219 8:57909496-57909518 TTTTCTGTTTCTTCTCCTTAAGG - Intergenic
1042737198 8:72002719-72002741 TTTTATTTATCTTCTCCTTTTGG + Intronic
1043412815 8:80016765-80016787 TTTTAGGCATGTACACATTAAGG - Intronic
1043827796 8:84949773-84949795 TTTTTTGTCTGTTCACTTTGGGG + Intergenic
1043957501 8:86378058-86378080 TTTTAATTATTTTCACTTTATGG + Intronic
1046204911 8:110981332-110981354 TTTCATGTCTGATGACCTTATGG - Intergenic
1048680895 8:136840375-136840397 TTTTATGTATTTTAACCTTATGG - Intergenic
1050246825 9:3698863-3698885 TTTTGTGTATGTTTGCCTCAAGG - Intergenic
1050399312 9:5234476-5234498 TATTAGGCATGTTCACCCTAGGG + Exonic
1050401530 9:5261264-5261286 TTATTTCAATGTTCACCTTACGG + Intergenic
1050886118 9:10768016-10768038 GTTTTTGTATGTTAACATTAGGG + Intergenic
1051012481 9:12434913-12434935 TTATATGTATCTTCATTTTAAGG + Intergenic
1051081081 9:13294326-13294348 TTTCGTGTATGTTCACATCATGG - Intergenic
1051835176 9:21328610-21328632 TTTTTTGTATGTTGACCTTTCGG - Intergenic
1054810304 9:69429019-69429041 GGTTATGTATGTTCACCTAAAGG - Exonic
1055128425 9:72746862-72746884 TTTTAGGCATGATCCCCTTAAGG - Intronic
1055448991 9:76413458-76413480 TTTTCTGTAATTTCATCTTAAGG - Intergenic
1056450033 9:86707733-86707755 TTTCATGCATTCTCACCTTAGGG - Intergenic
1058102328 9:100931049-100931071 TTTTCTGTATGTTTACCAAAGGG + Intergenic
1058882780 9:109299959-109299981 TGTTATTTCTGTTCACCGTAGGG - Intronic
1059249800 9:112878336-112878358 TTTGATATATTTTCACCTTCAGG + Intronic
1060385579 9:123224813-123224835 TTCTGTGTATGTTCAGCTTTAGG - Intronic
1060915042 9:127383699-127383721 TTTTATTTTTGTTCCCCTTTTGG + Intronic
1186811611 X:13195098-13195120 TTTTATGCATCTTTACCTAAAGG + Intergenic
1186982917 X:14977076-14977098 TTTTATCTGTGTGCACTTTATGG - Intergenic
1187895498 X:23976288-23976310 TTTTATGTACTTTTTCCTTATGG - Intergenic
1188103384 X:26118490-26118512 TTTGATAAATGTTCACCTTATGG + Intergenic
1188274135 X:28179025-28179047 TTTTATATATGTATACATTATGG + Intergenic
1189190998 X:39105802-39105824 TTTTCTTTATTTTCACATTAAGG + Intergenic
1189266179 X:39718335-39718357 TTTTATTTATCTTCACATAAAGG - Intergenic
1189334007 X:40158972-40158994 CTTTATTTACGTTCACCTCACGG - Intronic
1189683292 X:43538329-43538351 TGTTATGTATGATCACAATAAGG + Intergenic
1189843204 X:45104344-45104366 ATTTCTGTAAGTTTACCTTATGG - Intronic
1190013864 X:46809383-46809405 TTTTATATATGTTTACTTTGAGG + Intergenic
1190578428 X:51866266-51866288 TTTTATGAATGATCACTTTGTGG + Intronic
1192229773 X:69256883-69256905 ATTTAGGGATGCTCACCTTAAGG - Intergenic
1194057293 X:89151383-89151405 TTTTATTTATGGCCAGCTTAGGG - Intergenic
1194421341 X:93677261-93677283 TTGTGTGTATGTTCATATTAAGG - Intronic
1194563671 X:95454491-95454513 TTTTATGTTTCTTCTCCTGAAGG + Intergenic
1194839934 X:98727518-98727540 TATTATGTATTTTCACTTTAAGG + Intergenic
1195629443 X:107039210-107039232 TTTCATTTGTGTTCACCTCAAGG - Intergenic
1197027556 X:121773105-121773127 TTTGATGTATGTATACATTATGG + Intergenic
1198647515 X:138825425-138825447 TTTTATGTAGCTGCACATTATGG - Intronic
1200738011 Y:6821333-6821355 TTTCATGTATGTACATATTATGG + Intergenic
1201623953 Y:15992777-15992799 TCTTATGTTTCTTAACCTTAAGG + Intergenic