ID: 972149767

View in Genome Browser
Species Human (GRCh38)
Location 4:36074992-36075014
Sequence TTAGTTCCGCAAATCTATAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 98
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 95}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972149765_972149767 3 Left 972149765 4:36074966-36074988 CCTTGAATGTTAGTGAAGCATTT 0: 1
1: 0
2: 4
3: 7
4: 220
Right 972149767 4:36074992-36075014 TTAGTTCCGCAAATCTATAATGG 0: 1
1: 0
2: 0
3: 2
4: 95
972149764_972149767 4 Left 972149764 4:36074965-36074987 CCCTTGAATGTTAGTGAAGCATT 0: 1
1: 0
2: 0
3: 9
4: 156
Right 972149767 4:36074992-36075014 TTAGTTCCGCAAATCTATAATGG 0: 1
1: 0
2: 0
3: 2
4: 95
972149763_972149767 26 Left 972149763 4:36074943-36074965 CCTTTAATGTGCATCGTATCTAC 0: 1
1: 0
2: 0
3: 2
4: 49
Right 972149767 4:36074992-36075014 TTAGTTCCGCAAATCTATAATGG 0: 1
1: 0
2: 0
3: 2
4: 95

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972149767 Original CRISPR TTAGTTCCGCAAATCTATAA TGG Intronic
904777384 1:32919074-32919096 TCAGTTCCTCAAATGTAAAATGG + Intergenic
905156134 1:35983915-35983937 TTAGGTATGAAAATCTATAATGG + Intronic
909461581 1:75921359-75921381 GTAGTTCCCCTAATCTTTAAGGG - Intronic
912907219 1:113719471-113719493 AAAGTTCCACAAATCTCTAAGGG + Intronic
917673653 1:177299225-177299247 TTAGTTCCCCCAAACAATAAAGG - Intergenic
921047697 1:211489078-211489100 TCAGTTTCCCCAATCTATAAGGG + Intronic
1068573006 10:58651788-58651810 TTATTTCCCCAAATTTATAGTGG + Intronic
1070572615 10:77651335-77651357 TCAGTTCCTCAATTCTACAAAGG + Intergenic
1077744485 11:4886172-4886194 ATATTTCTGGAAATCTATAAAGG - Intronic
1079170270 11:18087207-18087229 TTAGTTCTGAAAATCCAGAATGG - Exonic
1087398117 11:97628500-97628522 TTAGTTCAGCATATATAGAATGG + Intergenic
1090192806 11:124787041-124787063 TTAATACAGCAAATCTATGATGG - Intronic
1097457930 12:59823181-59823203 TTATTTGAGCAAATCTATGATGG + Intergenic
1098841584 12:75484344-75484366 TTATTACCACAAATCTATTAAGG + Intronic
1107563240 13:41576573-41576595 CAAGTTCAGCATATCTATAATGG - Intronic
1109929240 13:69192664-69192686 TTAGTTCTGCAAAATTATCATGG - Intergenic
1110128011 13:71972313-71972335 TTAGTCCCACAAACCTGTAAAGG - Intergenic
1111573007 13:90112552-90112574 TAACTTCCACAAATCAATAAAGG + Intergenic
1113009285 13:105745053-105745075 TTACTTCTGGAAATCTAAAAAGG + Intergenic
1126014307 15:44335175-44335197 TTAGTTTTGCAAATGTATCATGG + Intronic
1126512388 15:49493828-49493850 TCAGTTACACAAATATATAAAGG + Intronic
1127823307 15:62679976-62679998 CTAGTTCAGCACATCTATATGGG + Intronic
1133598987 16:7320846-7320868 TTATTGCCCCAAATTTATAAGGG + Intronic
1134502589 16:14780818-14780840 TTAGTTCTACAACTCAATAATGG - Intronic
1134577974 16:15348077-15348099 TTAGTTCTACAACTCAATAATGG + Intergenic
1134724614 16:16409469-16409491 TTAGTTCTACAACTCAATAATGG - Intergenic
1134942817 16:18302390-18302412 TTAGTTCTACAACTCAATAATGG + Intergenic
1139787993 16:69409613-69409635 TCAGTTCCTCAACTCTACAACGG - Intergenic
1140637540 16:76933325-76933347 TTATTTCCTCAGATCTTTAATGG - Intergenic
1145788492 17:27609624-27609646 TTATTTCCCCAAATCTTGAAGGG + Intronic
1148001188 17:44388301-44388323 TTAGTTCTGCAAATCAATTTAGG + Intronic
1149128454 17:53264832-53264854 TGAGTTCCAAAATTCTATAATGG - Intergenic
1158315323 18:56205763-56205785 TTAGTTCTGCAAATATCTATGGG - Intergenic
1159199367 18:65163843-65163865 TTAGTTTCACAAATATATGAAGG - Intergenic
1159872485 18:73774298-73774320 TAATTTGCCCAAATCTATAAAGG + Intergenic
1164409332 19:27986159-27986181 TTAGTTTTGCAATTCTTTAAAGG - Intergenic
926474195 2:13302166-13302188 TTATTTCTTCAAATGTATAATGG + Intergenic
927118431 2:19927964-19927986 TTTGATTTGCAAATCTATAAAGG - Intronic
928117332 2:28555682-28555704 TTAGTTCAGCAAATATTTATTGG - Intronic
929319483 2:40525468-40525490 ATAGTTCCACATATCCATAAGGG + Intronic
936949078 2:117959049-117959071 AAAGTTCTGCAACTCTATAAGGG + Intronic
938643149 2:133302972-133302994 TTAGATCAGCAAAGCTATAAAGG + Intronic
940136734 2:150445580-150445602 TTAGATCAGCAAATAAATAAAGG - Intergenic
943820193 2:192312799-192312821 TTATTTTCTCAAATATATAAAGG + Intergenic
944197684 2:197072691-197072713 TTAAATCCGCAAATGTTTAAAGG + Intronic
946970747 2:225088230-225088252 TTAGTTCCGCAAATAAAGGAAGG - Intergenic
1172982872 20:38957814-38957836 TTAGTACAGCAATTCTGTAAAGG + Intergenic
1173892501 20:46523754-46523776 TAAGTTCCTCCAATATATAAAGG - Intergenic
1175340307 20:58224936-58224958 TGAGTTTCACAAATCTAAAAGGG - Intronic
1177286659 21:19060242-19060264 TTATTTCTACAAATATATAAAGG + Intergenic
1178141724 21:29691635-29691657 TTAATTCTGCAAATTTAGAACGG + Intronic
1178721147 21:35010279-35010301 TTACTACCCCAAATCTATATTGG - Intronic
1182979175 22:34652144-34652166 CTAGTTCCGTCAATCTAGAAGGG + Intergenic
1183291733 22:37006503-37006525 TTAGTTTCACAGATCTATGATGG + Intronic
951062816 3:18229874-18229896 TTAAATCCCCAAATCTAAAAAGG - Intronic
957595602 3:82261352-82261374 CTTGTTCCGCAAATCTGTCAGGG + Intergenic
959032773 3:101320514-101320536 TTCTTTCCGCTAATTTATAATGG - Exonic
963078535 3:141370110-141370132 ATAGAACCCCAAATCTATAATGG + Intronic
963466188 3:145685615-145685637 TTAATTGGGCAAATCTACAAAGG - Intergenic
963792691 3:149600592-149600614 TTATTTCCACTAATGTATAAAGG - Intronic
964595240 3:158419699-158419721 TTATGTGTGCAAATCTATAAAGG - Intronic
964909777 3:161765993-161766015 ATAGTTACTCAAATATATAAAGG + Intergenic
965350484 3:167606344-167606366 TAAGTTCCTCAGATCTATTATGG - Intronic
966435874 3:179883407-179883429 TTAGTTCAGCTAATCTATTTTGG + Intronic
972046646 4:34673171-34673193 TGAATGCCTCAAATCTATAAGGG - Intergenic
972149767 4:36074992-36075014 TTAGTTCCGCAAATCTATAATGG + Intronic
977380696 4:96270142-96270164 TTAGTTTCCAAACTCTATAAAGG - Intergenic
979837720 4:125393437-125393459 TTAGATCCACAAATATATAATGG + Intronic
982484925 4:155954842-155954864 TTAGTTCTAAAAATCTACAAGGG - Intergenic
987641708 5:20620700-20620722 AGAGTTCCTCAAATGTATAAGGG - Intergenic
990179867 5:53148880-53148902 TTACTTCCACAAAACTCTAAAGG + Intergenic
998032839 5:138887486-138887508 TTAGCTCCGCAAAGCTGTCATGG + Exonic
998149910 5:139750941-139750963 TTAGTTTCCCCCATCTATAATGG - Intergenic
999401517 5:151267958-151267980 TTAATTGGGCAAATCTAGAAAGG - Exonic
1008031996 6:46707148-46707170 TAAATTCCCCAAAGCTATAATGG - Intronic
1009829810 6:68915608-68915630 TTAGTTCTCCAAAACTACAAAGG - Intronic
1010308536 6:74353918-74353940 TTAGTTTTGAAAATATATAATGG + Intergenic
1014139158 6:117920353-117920375 TTAATTTCGCAAAGCTACAAAGG - Intronic
1015346724 6:132168997-132169019 TTAGTTCAACCAATCTACAAAGG + Intergenic
1020580796 7:9998074-9998096 TTAGTTCTTCAAATTTTTAATGG - Intergenic
1024847012 7:53657443-53657465 TTTGTCCTGCAAATCAATAAGGG + Intergenic
1031049873 7:116934142-116934164 TTAGTTCAGGAACTCAATAATGG + Intergenic
1031729691 7:125283562-125283584 TAAGTTCTGCATATCTATACTGG + Intergenic
1032618679 7:133503675-133503697 TTATTTCCGCAAATGTTTATTGG - Intronic
1035823523 8:2620320-2620342 TGAGTTCCTCAAGTCTATATTGG + Intergenic
1037149829 8:15623154-15623176 TAAATTCCGAAAATTTATAAAGG + Exonic
1039204314 8:35133262-35133284 TTAGTTTCGAAAATTTATATTGG - Intergenic
1039320574 8:36425830-36425852 TTAGTTCCTCAAATGTAATAAGG - Intergenic
1042028398 8:64447937-64447959 TTAGTTCAGGCAATCTACAATGG - Intergenic
1045074865 8:98553344-98553366 TTAGACTCTCAAATCTATAAGGG + Intronic
1046077433 8:109330382-109330404 TTAGTTCCACAAACCTTTGATGG - Intronic
1048189333 8:132273789-132273811 AAAGTTCCGCAAATCTCTAGGGG + Intronic
1055255238 9:74362077-74362099 TTACTTCCGCAAATATAAATAGG - Intergenic
1186616483 X:11193742-11193764 TTAGTTTAAAAAATCTATAATGG + Intronic
1188214625 X:27460786-27460808 TTAGCTCCTAAAATCTATATGGG - Intergenic
1190495222 X:51021776-51021798 TTAGTTTAGCAAAACTCTAAGGG + Intergenic
1198998068 X:142599075-142599097 TTTGTTCAGCAAATATATACCGG - Intergenic
1201564059 Y:15347569-15347591 TTAGTACCTCAAACCTATAGAGG - Intergenic