ID: 972154503 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 4:36142530-36142552 |
| Sequence | GAGTCCCTCTGGTGACTTGG GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 136 | |||
| Summary | {0: 1, 1: 0, 2: 0, 3: 5, 4: 130} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 972154503_972154508 | -4 | Left | 972154503 | 4:36142530-36142552 | CCCCCAAGTCACCAGAGGGACTC | 0: 1 1: 0 2: 0 3: 5 4: 130 |
||
| Right | 972154508 | 4:36142549-36142571 | ACTCCAAATCACTTATCTTATGG | 0: 1 1: 0 2: 1 3: 14 4: 199 |
||||
| 972154503_972154510 | 15 | Left | 972154503 | 4:36142530-36142552 | CCCCCAAGTCACCAGAGGGACTC | 0: 1 1: 0 2: 0 3: 5 4: 130 |
||
| Right | 972154510 | 4:36142568-36142590 | ATGGAGTATGTATTCTCACTAGG | 0: 1 1: 0 2: 1 3: 17 4: 158 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 972154503 | Original CRISPR | GAGTCCCTCTGGTGACTTGG GGG (reversed) | Intronic | ||