ID: 972154503

View in Genome Browser
Species Human (GRCh38)
Location 4:36142530-36142552
Sequence GAGTCCCTCTGGTGACTTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 136
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 130}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972154503_972154508 -4 Left 972154503 4:36142530-36142552 CCCCCAAGTCACCAGAGGGACTC 0: 1
1: 0
2: 0
3: 5
4: 130
Right 972154508 4:36142549-36142571 ACTCCAAATCACTTATCTTATGG 0: 1
1: 0
2: 1
3: 14
4: 199
972154503_972154510 15 Left 972154503 4:36142530-36142552 CCCCCAAGTCACCAGAGGGACTC 0: 1
1: 0
2: 0
3: 5
4: 130
Right 972154510 4:36142568-36142590 ATGGAGTATGTATTCTCACTAGG 0: 1
1: 0
2: 1
3: 17
4: 158

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972154503 Original CRISPR GAGTCCCTCTGGTGACTTGG GGG (reversed) Intronic