ID: 972156772

View in Genome Browser
Species Human (GRCh38)
Location 4:36172819-36172841
Sequence CTGGTGTTTCCCAGGAAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2191
Summary {0: 1, 1: 0, 2: 4, 3: 189, 4: 1997}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972156772_972156775 -10 Left 972156772 4:36172819-36172841 CCAGCTTTCCTGGGAAACACCAG 0: 1
1: 0
2: 4
3: 189
4: 1997
Right 972156775 4:36172832-36172854 GAAACACCAGATGCAGAGTTGGG 0: 1
1: 0
2: 1
3: 23
4: 232
972156772_972156778 18 Left 972156772 4:36172819-36172841 CCAGCTTTCCTGGGAAACACCAG 0: 1
1: 0
2: 4
3: 189
4: 1997
Right 972156778 4:36172860-36172882 TACAAAACCCAGAGAATTTGAGG 0: 1
1: 0
2: 2
3: 22
4: 298

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972156772 Original CRISPR CTGGTGTTTCCCAGGAAAGC TGG (reversed) Intronic
Too many off-targets to display for this crispr