ID: 972158156

View in Genome Browser
Species Human (GRCh38)
Location 4:36190725-36190747
Sequence ATGTTTGCACAGAATGTTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 297
Summary {0: 1, 1: 0, 2: 0, 3: 29, 4: 267}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972158156 Original CRISPR ATGTTTGCACAGAATGTTGA TGG Intronic
901168790 1:7239113-7239135 ATGCTTCCAAATAATGTTGAGGG - Intronic
902060103 1:13634830-13634852 ATCTTTGCACAGGGGGTTGAAGG - Intergenic
903288408 1:22291601-22291623 ATGTTTGGACTGAGTCTTGATGG + Intergenic
903933271 1:26876847-26876869 ATGGGTGCAGAGAATGCTGAGGG + Exonic
904722843 1:32523591-32523613 ATGTCTGAACTGAATATTGAAGG + Intronic
905176592 1:36139867-36139889 ATGTTTGAACATAAGGTTGTTGG + Intronic
907155821 1:52332849-52332871 GTGTGTGTACAGAATGATGATGG + Exonic
907810924 1:57868943-57868965 GTGTTTGAACAGAACCTTGAAGG - Intronic
908927696 1:69276079-69276101 TTGTTTGCTCAAAATATTGAAGG - Intergenic
910781457 1:90939989-90940011 ATGCTTGTAGAGAATGTGGACGG - Exonic
910939594 1:92518912-92518934 ATTTTTTCTCAGAATTTTGAAGG - Intronic
911046802 1:93635552-93635574 ATATTTGCAGAGAATGTTTTTGG + Intronic
914381323 1:147119012-147119034 TTGTTTGCAGAGAATGATGAAGG - Intergenic
915881220 1:159673750-159673772 ATATTTGCACAGAATATTTCTGG + Intergenic
916362458 1:163985660-163985682 ATGTATGGACAAAATGTTGTGGG + Intergenic
916744438 1:167673873-167673895 ATGTTTACGCAGAGTCTTGAAGG - Intronic
917263995 1:173200246-173200268 AGGTTTGCACAGAAAGGTCAGGG - Intronic
917678509 1:177342351-177342373 GTGTTTACAAAGAATGTGGATGG - Intergenic
918630446 1:186710838-186710860 ATGTTCGCACACACTGGTGATGG + Intergenic
919158885 1:193803089-193803111 ATTTTTGGAGAGAATGTTAAAGG + Intergenic
919689193 1:200513904-200513926 ATGTTTTCATATAATGGTGATGG + Intergenic
919800230 1:201349585-201349607 ATGTTTGCCCAGGAAGTTGAGGG - Intergenic
920498094 1:206469646-206469668 ATGTTTCTATAGAATGTTGGAGG - Intergenic
922456642 1:225778577-225778599 ATGTTTGCAAACAATTTTAAGGG + Intronic
924007800 1:239631410-239631432 AAGTTTGCACAGCATGGTGACGG - Intronic
924360218 1:243232476-243232498 ATGTTTGAACAAAATATTGTGGG - Intronic
1063806428 10:9648555-9648577 ATGTTTGCAAAAAATGTTTAAGG - Intergenic
1067070629 10:43128566-43128588 ATGTGAACACAGAATGTTGGTGG - Exonic
1067268181 10:44765895-44765917 GTGTTTGCTCAGAATGCTGTTGG - Intergenic
1067458159 10:46438427-46438449 ATATTTGAACTGAATGTTGAAGG + Intergenic
1067629037 10:47946207-47946229 ATATTTGAACTGAATGTTGAAGG - Intergenic
1068744383 10:60513665-60513687 AATTTTTCACAGTATGTTGAGGG - Intronic
1069384384 10:67871204-67871226 ATGATTTCATACAATGTTGAAGG - Intergenic
1069762774 10:70825481-70825503 ATTCTTGAACAGAATCTTGAAGG + Intronic
1070042466 10:72795117-72795139 ATTTTAGGACAGAATTTTGAAGG - Intronic
1070197362 10:74171089-74171111 ATGTTTCCACAGACTTTTTAGGG - Intronic
1071376793 10:85013968-85013990 ATATTTGTAGAGAATGTTTAAGG - Intergenic
1071860373 10:89666321-89666343 ATGTTTACACTAAATGTTAAAGG + Intergenic
1072799238 10:98381384-98381406 ATGTTTTCAAAGAATTTTTATGG + Intergenic
1072943992 10:99793303-99793325 ATGTTAGCCAAGAATGTAGAAGG - Intronic
1076213820 10:128676148-128676170 ATGTTTACACATAATGTAGCAGG - Intergenic
1077395729 11:2320248-2320270 ATGTTTGCACAATTTGTTGAAGG + Intergenic
1078498950 11:11849916-11849938 ATTTTTTCTCAGAATTTTGAAGG + Intronic
1079170326 11:18088032-18088054 ATGTTTACACAGAAACATGAAGG + Intronic
1080916491 11:36665612-36665634 TGGTTTGTACAGAAAGTTGAGGG - Intergenic
1085250880 11:75143021-75143043 GTGTGTGCACAGAATGTGGGGGG + Intronic
1085928494 11:81052747-81052769 ATGTTTGTAAATCATGTTGAAGG - Intergenic
1086386434 11:86313737-86313759 ATGTTTGTACAAAGTGTGGAGGG + Intronic
1087056900 11:93945599-93945621 CTGTTTGAACAGAATTTTTAGGG + Intergenic
1088240365 11:107768101-107768123 GTGTTTGAACAGAACCTTGAGGG - Intergenic
1088319277 11:108538474-108538496 GTGTTTGCTCAGAATGTATAAGG - Intronic
1088332454 11:108667774-108667796 AAGTTTGCACTAAATCTTGAAGG - Intronic
1089430987 11:118424324-118424346 CTATTTGAACAGAGTGTTGAAGG - Intronic
1090367334 11:126217847-126217869 AGGTTCTCTCAGAATGTTGAAGG + Intronic
1090522337 11:127492645-127492667 AAGTATGAACAGAATCTTGATGG + Intergenic
1090692169 11:129195402-129195424 ATTTTTACACAGAATACTGAAGG + Intronic
1090695754 11:129239775-129239797 CTGTTTGCACAGATTGAGGATGG - Intronic
1092075610 12:5670942-5670964 AGGTTTCCACAGAATGTTAGAGG + Intronic
1094343822 12:29443877-29443899 ATCTTTACAAAGAATGTTGGAGG - Intronic
1097021512 12:56023918-56023940 ATGTTAGCAGATAATGTAGAAGG + Intronic
1100903541 12:99271373-99271395 ACGTTTTTACAGAATGTTAAGGG - Intronic
1101067721 12:101040104-101040126 AAGCTTGCACAGAATGATTAGGG + Intronic
1102419215 12:112790863-112790885 ATGTTTGGACAGAGTGATAAAGG - Intronic
1102445549 12:112999484-112999506 CCGTTTGCACAGAAGTTTGAAGG + Intronic
1103236054 12:119373615-119373637 AAGTTTGCACAGATTTTTGGTGG - Intronic
1105729707 13:23200763-23200785 ATCTTTGCACAGAGAGTTGAGGG + Intronic
1107218566 13:37952087-37952109 AATTTTGCAAAGAATGTTAATGG + Intergenic
1107689025 13:42933579-42933601 ATGGTTGACCAGAAGGTTGAAGG - Intronic
1108133132 13:47325171-47325193 CTGTTTGCCCAGAATGCTCAGGG - Intergenic
1109562384 13:64069040-64069062 AGAGTTACACAGAATGTTGAGGG - Intergenic
1111101136 13:83588274-83588296 ATTTTTGCACATAGTGTTAATGG + Intergenic
1111841582 13:93456166-93456188 ATGTTTGCAATGAATGATTAAGG - Intronic
1112144459 13:96681907-96681929 ATGTTTGAACAGAATACTAAAGG - Intronic
1112249217 13:97763711-97763733 ATATTTGAACAGAAATTTGAGGG + Intergenic
1112415231 13:99199012-99199034 ATGTTTGCAGAAGCTGTTGATGG - Intergenic
1113340475 13:109418978-109419000 ATGTTTGCAAAGAATGATAAGGG - Intergenic
1115051450 14:29068638-29068660 AAATGTGCACAGAATGTAGAAGG - Intergenic
1115692518 14:35859399-35859421 ATGTTTCCTCAGAATTTTGAAGG + Intronic
1118669956 14:68113994-68114016 TTGTTTGTACTGAATGTTGGTGG - Intronic
1118841462 14:69516506-69516528 ATGTTTTCAAAGAATGTTAAAGG - Intronic
1119116141 14:72023502-72023524 ATGTTTGCTCAAAATGTCAAGGG + Intronic
1119889000 14:78168571-78168593 ATTTGTCCACAGAATGTGGAAGG - Intergenic
1120280117 14:82428765-82428787 TTGTTTACACAGAAAGGTGAGGG - Intergenic
1120453197 14:84697685-84697707 ATTTTTGCATACAATTTTGAGGG - Intergenic
1121295806 14:92821016-92821038 ATGGAGGCACAGAATGGTGATGG + Intronic
1121395882 14:93622800-93622822 CAGTTTGTCCAGAATGTTGAAGG - Exonic
1122619275 14:103045244-103045266 ATGTTTTTAGAGAATGATGAGGG + Intronic
1123480161 15:20623878-20623900 ATGTGTTCACAGAATGATTATGG + Intergenic
1123586564 15:21765591-21765613 AGGTTTCCACAGAATGTTAGAGG - Intergenic
1123623203 15:22208156-22208178 AGGTTTCCACAGAATGTTAGAGG - Intergenic
1123637843 15:22376485-22376507 ATGTGTTCACAGAATGATTATGG - Intergenic
1125467076 15:39964430-39964452 ATGTCTGCACACATTTTTGATGG + Intronic
1127455129 15:59150123-59150145 ATGTTTGCACAGCAGATTTAAGG + Intronic
1128820466 15:70647979-70648001 ATGTTGGGAAAGAATGTTTAAGG + Intergenic
1130718042 15:86355893-86355915 ATGTTTGCAAAGAATGAAGCAGG - Intronic
1131810654 15:96169570-96169592 ATGTGTGCATAGTATGTTTAGGG - Intergenic
1132196159 15:99916207-99916229 GTGTTTCCACAGCATGTTGCAGG - Intergenic
1133044087 16:3076541-3076563 CTTTTTGCACAGAAGTTTGAGGG - Intronic
1134475617 16:14570900-14570922 ATTTATGCCCAGAAGGTTGAGGG + Intronic
1134675594 16:16087989-16088011 ATGTTTACACAGAATGTTAGTGG - Intronic
1135882071 16:26267607-26267629 AAGTTTGCAAAGAAGCTTGAAGG - Intergenic
1137639465 16:50015744-50015766 ATGATTGCACAGCAGGATGAAGG - Intergenic
1138618325 16:58190411-58190433 ATGGTTGCCAAGAATGTAGAAGG + Intronic
1138856881 16:60704938-60704960 ATGTTTGCAGAAAATGCAGAGGG - Intergenic
1140214968 16:72999992-73000014 AGGTGTGCACAGAGTTTTGAAGG + Intronic
1140886379 16:79247562-79247584 ATGTTTGCGCAGAGTGTTTTGGG - Intergenic
1141955438 16:87367873-87367895 ATCTTTGCTCAGATTGCTGAAGG + Intronic
1142725197 17:1808661-1808683 AGGTTTGCTCTGAATGTGGAGGG - Intronic
1142906563 17:3046849-3046871 TTATTTCCACAGAATTTTGAGGG + Intergenic
1146464972 17:33079308-33079330 ATGTTTGCACTGAATCTTGGAGG + Intronic
1148982275 17:51588135-51588157 ATGTTTGCACTGAATGACAAAGG - Intergenic
1150158775 17:62876138-62876160 GTGTGTCCACAGAATGTTCAGGG - Intergenic
1150521229 17:65867916-65867938 ATTTTTTCAAATAATGTTGAAGG + Intronic
1153493662 18:5675602-5675624 ATGTGTGCACAGAATCTCGGAGG - Intergenic
1155710879 18:28877632-28877654 ATATTTGAACAGTATGTTAAGGG - Intergenic
1157409490 18:47451905-47451927 CTGTCTGCACAGAAGGTAGAAGG + Intergenic
1157977326 18:52341293-52341315 AAGTCTGCGCAGAATGTAGATGG + Intronic
1158861861 18:61600349-61600371 ATGTTTGCTTAGAATATTGAAGG + Intergenic
1159773541 18:72577099-72577121 ATATGTACAAAGAATGTTGATGG + Intronic
1159842078 18:73410954-73410976 AAGTTTGCACAAATTCTTGATGG - Intergenic
1160049674 18:75421249-75421271 ACGTTTACACAGAATGCTGTAGG - Intronic
1162300288 19:9841243-9841265 GTTCTTGCACAGAATCTTGAAGG + Intronic
1164469904 19:28521544-28521566 TTTTTTACACAGAATGGTGATGG + Intergenic
1166070676 19:40385596-40385618 ATGCTTTCACAGAATGATTAGGG - Intronic
925244995 2:2373987-2374009 TTATTTGCATAGAATGTTTATGG + Intergenic
927885807 2:26717817-26717839 AGGTTTGAACAGAATGGAGACGG - Intronic
929046010 2:37791266-37791288 GTTTTTGCTCAGAATTTTGAAGG - Intergenic
929167490 2:38897798-38897820 ACATTTGCACAAAATATTGAAGG + Intronic
930279513 2:49353738-49353760 ATGGTTGCACAGTGTGATGAGGG + Intergenic
932716645 2:74105277-74105299 ATGTTTGCACTGCACGTGGATGG - Exonic
933257844 2:80100808-80100830 ATGTATGCTCAGAAGGTTGAAGG - Intronic
933512982 2:83264414-83264436 ATTTTCTCCCAGAATGTTGAAGG - Intergenic
936135626 2:109891032-109891054 ATGTTTGGAAGGAAAGTTGAAGG + Intergenic
936209071 2:110480453-110480475 ATGTTTGGAAGGAAAGTTGAAGG - Intergenic
937658703 2:124406439-124406461 ATGTTTGCAAGGCATGTAGAAGG - Intronic
937691198 2:124757333-124757355 CTGTGTGCACAGAATGGGGATGG + Intronic
938792092 2:134685657-134685679 ATGATTGCATAAAATGCTGATGG - Intronic
939063181 2:137449286-137449308 ATGTTTGTGTAGAATGATGAAGG + Intronic
939474221 2:142665414-142665436 ATGTTAGCACCGAATCTTGTTGG + Intergenic
940955999 2:159728077-159728099 ATGTTTTCAAAGATTGTTTATGG - Intronic
941465793 2:165825285-165825307 ATTTTCCCTCAGAATGTTGAAGG + Intergenic
941774700 2:169379943-169379965 ATGTATCCACAGAGTGTTAAAGG + Intergenic
941960545 2:171249095-171249117 ATGCTTGCACAAACTGTTTAGGG + Intergenic
942272139 2:174287076-174287098 ATGTTTGCTCAGACTCATGATGG - Intergenic
942548134 2:177086040-177086062 ATCGTTCCACAAAATGTTGATGG + Intergenic
942692429 2:178600195-178600217 ATATTTACACAGAATTATGAAGG + Intronic
945005085 2:205396659-205396681 ATGTTTGCACAGAATTTTTTAGG + Intronic
945511243 2:210705778-210705800 ATATTTGAACTGAATCTTGAAGG + Intergenic
945804176 2:214469890-214469912 ATGGTTGTAAAGAATGGTGATGG + Intronic
947256171 2:228166200-228166222 ATGTTTACATACAATTTTGAAGG + Intronic
947906214 2:233765202-233765224 ATGTTTGCAAAGAATACTGAGGG - Intronic
948926328 2:241101047-241101069 ATTTTTCCACAGACTGGTGAGGG + Intronic
1169956191 20:11105587-11105609 ATGTTTGCGGAGAATGGAGAAGG + Intergenic
1176724254 21:10416903-10416925 ATGTTTGAATAGAATCTTAAAGG + Intergenic
1179547119 21:42120215-42120237 GTGTTTGCACAGATTGCTGGTGG + Intronic
1180902146 22:19381982-19382004 AAATTTGCACAGAAAGTGGATGG - Intronic
1181415666 22:22756938-22756960 TTTTTTGCACAGAATGTGGAGGG - Intronic
1184981982 22:48101423-48101445 ATGTTTGCAGAGAGTGGTGCAGG - Intergenic
949627025 3:5878410-5878432 ATGTTTTTAAACAATGTTGATGG + Intergenic
950110817 3:10417450-10417472 ATGTTTACACAGAAGCTGGACGG + Intronic
950322312 3:12068281-12068303 ATTTTTCCTTAGAATGTTGAAGG + Intronic
951419024 3:22462007-22462029 ATGTTTGCCAAGGATGTGGAAGG - Intergenic
954471427 3:50699428-50699450 ATTTCTGCAAAGAATGTTGTTGG + Intronic
956017172 3:64895799-64895821 ATGATTCCACAGTATTTTGAAGG - Intergenic
956684560 3:71812817-71812839 ATTCTTACAAAGAATGTTGATGG - Intergenic
957151692 3:76494506-76494528 CTGTTTGTACAGAATTTTGGGGG + Intronic
957485028 3:80849716-80849738 ATATTTGCATAGAATATTAAAGG + Intergenic
957695216 3:83627743-83627765 AATTTTGCACAGAATTTTTATGG - Intergenic
957846572 3:85744593-85744615 ATGTTTGGACAGAATGAAGGTGG + Intronic
958007962 3:87837037-87837059 ATGTTTGCAAAGAATTCAGAAGG + Intergenic
958050732 3:88341854-88341876 ATGTTTGAAAACAATGGTGATGG + Intergenic
958116576 3:89227082-89227104 ACGTTTGCATATAATATTGATGG - Intronic
959177141 3:102927737-102927759 ATGTATGTACAAAATGTTAATGG - Intergenic
959217386 3:103469120-103469142 ATGTTTACTCAGAATGTGTATGG - Intergenic
959384721 3:105688991-105689013 ATATTTGAACAGAAACTTGAAGG - Intronic
960093009 3:113660862-113660884 ATGTGTGCAAAGAATGATGTTGG + Exonic
960194085 3:114743611-114743633 ATGTTTCCACATGATGCTGATGG - Intronic
961842148 3:129723675-129723697 CTATTTGGACAGAATGTAGAGGG - Intronic
962123347 3:132587711-132587733 ATTCCTCCACAGAATGTTGATGG + Intronic
963920865 3:150903406-150903428 ATATTTGCACAGAATCATGAAGG - Exonic
963922910 3:150923289-150923311 ATATTTGGAAAGAATCTTGAAGG + Intronic
964351547 3:155807999-155808021 AAGTATGCACAGAATGATTAAGG + Intergenic
965437755 3:168673350-168673372 ATCTTTGCACAAGATGTTTATGG - Intergenic
967357935 3:188594248-188594270 ATTTTTACCCAGAATCTTGAAGG + Intronic
967516833 3:190379902-190379924 ATGTTTCCACAAAATGTTATAGG - Intronic
968484131 4:850592-850614 GTGTTTGCAGAGACTGTTGAGGG - Intronic
968836472 4:2968557-2968579 ATGTGTGCTCAGAATGTTCCAGG + Intronic
969496458 4:7529196-7529218 ATGTTTGCACAGAGTCTGGAAGG - Intronic
971475044 4:27064934-27064956 ACGTTTGCATACAATGTTCATGG - Intergenic
972158156 4:36190725-36190747 ATGTTTGCACAGAATGTTGATGG + Intronic
972169255 4:36324921-36324943 ATGATTGCAGAGAATGTTTAGGG + Intronic
972443973 4:39125771-39125793 ATGATTGCACAACATGGTGAAGG + Intronic
972903695 4:43718031-43718053 ATCTTTGCACAAAATCTTAAAGG + Intergenic
974471187 4:62319877-62319899 ATATTTGAACAGAAACTTGAAGG + Intergenic
974506551 4:62781465-62781487 AGTTTTGCAAAGAATGTTGCAGG + Intergenic
976896066 4:90113395-90113417 ATGCCTGCCCAGATTGTTGAGGG - Intergenic
977597898 4:98903765-98903787 ATGTTTACACAGAATGATTAAGG + Intronic
977877969 4:102171443-102171465 ATGTTTGTTTAGAATGCTGAAGG + Intergenic
978054152 4:104242237-104242259 ATGTTTGCAGATATTGTAGAGGG + Intergenic
978591401 4:110328588-110328610 ATTTTTCCTCAAAATGTTGATGG + Intergenic
978964416 4:114724346-114724368 ATGGTTGCAGAAAATTTTGATGG - Intergenic
978999951 4:115204400-115204422 AAGTTTGCACAGCAAGTTGAAGG + Intergenic
979395711 4:120186797-120186819 ATGCTTGAACTGAATTTTGAAGG + Intergenic
981164465 4:141540932-141540954 ATGGTTGCACAAAATTGTGACGG + Intergenic
981713337 4:147730652-147730674 CTGTTTGGACAGCATGTTGTAGG - Intergenic
981815421 4:148825603-148825625 ATTTTTAGACAGAATGTTGCAGG + Intergenic
982760932 4:159282171-159282193 ATTTTTAAATAGAATGTTGATGG + Intronic
984176427 4:176423988-176424010 TTGTTTGCTCAGAATTATGAGGG - Intergenic
985220660 4:187700496-187700518 ATGCATGCAAAGATTGTTGAAGG + Intergenic
988490171 5:31699313-31699335 ATTTTTGAGCTGAATGTTGAAGG + Intronic
989732461 5:44664696-44664718 GTGTGTGGACAGCATGTTGATGG + Intergenic
989819596 5:45779911-45779933 ATGTTGGCACAGGATGTAAAAGG - Intergenic
990147408 5:52778269-52778291 ATCTTTGCTCAAATTGTTGAAGG - Intergenic
990926294 5:61028649-61028671 ATATTTGTACAGGATGTTTATGG - Intronic
990993964 5:61712639-61712661 ATGTTTCCACAGAATGTTTGAGG - Intronic
994239003 5:97398645-97398667 ATGTTAGATCAGAATGATGAAGG + Intergenic
994733400 5:103521866-103521888 AGGTTTGCAAAGAATATAGAAGG + Intergenic
994763815 5:103890919-103890941 ATGTTTACAAAGTATTTTGAAGG + Intergenic
994796424 5:104306575-104306597 GTTTTTGCACAGAATATAGAGGG - Intergenic
997391750 5:133522940-133522962 GTGTTTCCACAGAATGTGTAAGG + Intronic
999532114 5:152475370-152475392 TTTTTTGTACAGAATGCTGAGGG - Intergenic
1000820905 5:165982175-165982197 ATTTTTCTTCAGAATGTTGAAGG + Intergenic
1001473666 5:172033974-172033996 ACATTTGCCCAGAATGTTCAAGG + Intergenic
1006528025 6:34625055-34625077 CTCTTTGGAGAGAATGTTGATGG - Intronic
1008203796 6:48627416-48627438 ATGTTTGAAGAGAAAGTTAAGGG + Intergenic
1009354250 6:62721601-62721623 TGGTTTCCACTGAATGTTGATGG + Intergenic
1010110726 6:72227144-72227166 ATATTAGCATATAATGTTGATGG + Intronic
1010712582 6:79192516-79192538 ATGTCTGAGCAGAAGGTTGATGG - Intergenic
1013492998 6:110668292-110668314 TTGTTTGCATAGGATTTTGATGG - Intronic
1013805865 6:113995157-113995179 ATGTCTGCACAGAGCCTTGAAGG - Intronic
1014556406 6:122846115-122846137 ATGTTTTCAGAAAATGCTGAGGG - Intergenic
1016089447 6:139958601-139958623 ATATATGCACAAAATGTTAAGGG + Intergenic
1016292267 6:142538653-142538675 AAGCTTGCACTGAATATTGAGGG - Intergenic
1017017238 6:150111429-150111451 CAGGATGCACAGAATGTTGATGG - Intergenic
1019775454 7:2909660-2909682 ATGTTTGGGCGGAATGGTGAGGG - Intronic
1020462226 7:8438772-8438794 ATGTTTGCAAAGTATGTTTCTGG + Intronic
1020647049 7:10827132-10827154 ATTTTTGCATAGAGTGTTAAAGG + Intergenic
1022159289 7:27692762-27692784 AAATTTGCAAAGAATTTTGAAGG + Intergenic
1023484189 7:40666517-40666539 ATGTTTTCAAAGAATGAAGAAGG + Intronic
1023670407 7:42570450-42570472 ATCTAGGCACAGAATGATGATGG + Intergenic
1024279016 7:47702991-47703013 ATGTTTCCTCAGACTTTTGAAGG + Intronic
1024514876 7:50240083-50240105 AGTTTTGCAAAGAATGATGATGG - Intergenic
1025110004 7:56206870-56206892 ATGCTTTCAGAGAATGTTTAAGG + Intergenic
1026307834 7:69157474-69157496 ATGCTTTCAGAGAATGTTTAAGG - Intergenic
1028000940 7:85497694-85497716 ATATATGCATATAATGTTGAAGG + Intergenic
1028016176 7:85716359-85716381 ATGTTTGCAAAGATAGTTGAAGG + Intergenic
1028410934 7:90529893-90529915 CTGTTTGCAGAGGATGTGGATGG - Intronic
1029175663 7:98662661-98662683 ATTTTTGCAGAGACTGTTTAAGG + Intergenic
1030878413 7:114845342-114845364 ATTTATGCACAGAAACTTGAAGG + Intergenic
1031033682 7:116764001-116764023 ATGTTTTAACAACATGTTGAAGG - Intronic
1032447942 7:132000784-132000806 AGGTTTGCACAAAGTGTTGAAGG + Intergenic
1032576077 7:133056434-133056456 ATGTTTGAGCTGAATATTGAAGG - Intronic
1037434937 8:18852563-18852585 ATGTTTTCACAAAGTGCTGATGG + Intronic
1038046574 8:23770422-23770444 ATTTTCCCTCAGAATGTTGAAGG - Intergenic
1038326113 8:26573971-26573993 ATTTATGCACAAAATGTTAAGGG + Intronic
1038892637 8:31743842-31743864 ATGTTTCTACAGAAGCTTGAAGG - Intronic
1039561406 8:38515109-38515131 ATGTTTGAACAGGGTCTTGAAGG - Intronic
1040412496 8:47168646-47168668 ATATGTGCATAGAATTTTGATGG + Intergenic
1041190703 8:55351091-55351113 ATGTTTGCACAGCAATGTGATGG + Intronic
1041467427 8:58170789-58170811 ATGTGTGCCCATAATATTGATGG + Intronic
1041530623 8:58861793-58861815 ATTTTTCCACGGAATGTTAATGG + Intronic
1043550248 8:81363498-81363520 ATGTTTGAAGAGGATGTTCAAGG + Intergenic
1044390275 8:91641805-91641827 ATGTATGCACAGAATTTATATGG - Intergenic
1045559205 8:103244675-103244697 CTGTAAGCACAGAATGATGAAGG + Intergenic
1046053459 8:109051509-109051531 ATGTTTAGGCAGAATTTTGAAGG - Intergenic
1046060937 8:109139034-109139056 ATAATTTCACAGAATGTTAATGG + Intergenic
1046150811 8:110222197-110222219 TTCTTTGTTCAGAATGTTGAAGG + Intergenic
1046534414 8:115490788-115490810 ATGTTTTCCCAGAATTTTGGAGG + Intronic
1046712972 8:117534002-117534024 ATGTTTCCTCAGAAATTTGAAGG + Intronic
1048316137 8:133363775-133363797 AGGTTTGCAGAGAATTTTGATGG - Intergenic
1049364217 8:142228927-142228949 ATGTGTGAACAGATTGTGGATGG + Intronic
1050069137 9:1792056-1792078 ATGTCTGGACGGAATCTTGAGGG - Intergenic
1051064605 9:13087736-13087758 ATTTATGCACAAAATGCTGAAGG + Intergenic
1051128105 9:13828381-13828403 ATATATGGACAAAATGTTGATGG - Intergenic
1052031035 9:23629268-23629290 TTATTAGCACAGCATGTTGAAGG + Intergenic
1052564702 9:30134453-30134475 ATTTTTCCACAGGATGTTGGGGG + Intergenic
1055399823 9:75911417-75911439 ATATTTGCAATGAATGTTGAAGG - Intronic
1056008261 9:82297639-82297661 ATTTTTCCTCAGAATTTTGAAGG + Intergenic
1056673349 9:88650917-88650939 AGGTTTGAACTGAATTTTGAAGG + Intergenic
1056694524 9:88834964-88834986 ATTCTTCCACAGAATTTTGAAGG - Intergenic
1057477615 9:95416294-95416316 AATTATGAACAGAATGTTGATGG - Intergenic
1059416162 9:114163759-114163781 ACATTTGCACAAAATGTTGCTGG - Intronic
1059980753 9:119769336-119769358 AGCTTTGCAAAGAATGTTTAAGG + Intergenic
1060015368 9:120081980-120082002 ATGTATTCACAGGGTGTTGAGGG + Intergenic
1060620115 9:125057643-125057665 CAGCTTGCACAGGATGTTGAAGG + Intronic
1061633276 9:131887774-131887796 ATGCTTGCTCAGAATACTGAAGG - Intronic
1185778360 X:2824299-2824321 ATGTTTAAACAGCATGTTTAGGG - Intergenic
1185942998 X:4342107-4342129 ATGATTTCACATAATGTTGCAGG - Intergenic
1188508270 X:30906794-30906816 CAGTTTGCACAGAATATTGTTGG - Intronic
1192673182 X:73167852-73167874 ATGGTTGCACTGGATGTTTAGGG - Intergenic
1194950859 X:100124012-100124034 ATGTGTGCCTAGAATGCTGAAGG - Intergenic
1195315710 X:103675658-103675680 ATCTTTGCTCAAATTGTTGAAGG - Exonic
1196604455 X:117640942-117640964 AGGTTTGCAAAGCATGTTCAGGG - Intergenic
1197176607 X:123493011-123493033 ATGTTTTCACCGAATGTAAATGG - Intergenic
1200492529 Y:3845080-3845102 ATTATTGAACAGAATATTGAGGG - Intergenic
1201291581 Y:12425431-12425453 ATGTTTAAACAGCATGTTTAGGG + Intergenic
1201559179 Y:15297987-15298009 ATGTTTGCATTGAATATAGATGG - Intergenic