ID: 972163423

View in Genome Browser
Species Human (GRCh38)
Location 4:36253326-36253348
Sequence AAGGAGAAACAGGGTGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972163423_972163435 15 Left 972163423 4:36253326-36253348 CCCTCCTCACCCTGTTTCTCCTT No data
Right 972163435 4:36253364-36253386 GTGCTGTGGAGGTTGCAACTAGG No data
972163423_972163432 1 Left 972163423 4:36253326-36253348 CCCTCCTCACCCTGTTTCTCCTT No data
Right 972163432 4:36253350-36253372 GGGTTATGACTCCAGTGCTGTGG No data
972163423_972163433 4 Left 972163423 4:36253326-36253348 CCCTCCTCACCCTGTTTCTCCTT No data
Right 972163433 4:36253353-36253375 TTATGACTCCAGTGCTGTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972163423 Original CRISPR AAGGAGAAACAGGGTGAGGA GGG (reversed) Intergenic
No off target data available for this crispr