ID: 972163435

View in Genome Browser
Species Human (GRCh38)
Location 4:36253364-36253386
Sequence GTGCTGTGGAGGTTGCAACT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972163431_972163435 -4 Left 972163431 4:36253345-36253367 CCTTGGGGTTATGACTCCAGTGC No data
Right 972163435 4:36253364-36253386 GTGCTGTGGAGGTTGCAACTAGG No data
972163423_972163435 15 Left 972163423 4:36253326-36253348 CCCTCCTCACCCTGTTTCTCCTT No data
Right 972163435 4:36253364-36253386 GTGCTGTGGAGGTTGCAACTAGG No data
972163427_972163435 11 Left 972163427 4:36253330-36253352 CCTCACCCTGTTTCTCCTTGGGG No data
Right 972163435 4:36253364-36253386 GTGCTGTGGAGGTTGCAACTAGG No data
972163424_972163435 14 Left 972163424 4:36253327-36253349 CCTCCTCACCCTGTTTCTCCTTG No data
Right 972163435 4:36253364-36253386 GTGCTGTGGAGGTTGCAACTAGG No data
972163430_972163435 5 Left 972163430 4:36253336-36253358 CCTGTTTCTCCTTGGGGTTATGA No data
Right 972163435 4:36253364-36253386 GTGCTGTGGAGGTTGCAACTAGG No data
972163429_972163435 6 Left 972163429 4:36253335-36253357 CCCTGTTTCTCCTTGGGGTTATG No data
Right 972163435 4:36253364-36253386 GTGCTGTGGAGGTTGCAACTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972163435 Original CRISPR GTGCTGTGGAGGTTGCAACT AGG Intergenic
No off target data available for this crispr