ID: 972163658

View in Genome Browser
Species Human (GRCh38)
Location 4:36256482-36256504
Sequence CAGGCTTTCCAATTTAAAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972163658_972163659 -8 Left 972163658 4:36256482-36256504 CCTACTTTAAATTGGAAAGCCTG No data
Right 972163659 4:36256497-36256519 AAAGCCTGTCTCGCTTGTTTCGG No data
972163658_972163663 15 Left 972163658 4:36256482-36256504 CCTACTTTAAATTGGAAAGCCTG No data
Right 972163663 4:36256520-36256542 TGTGGTGAGTGAAATGGAGAAGG No data
972163658_972163662 9 Left 972163658 4:36256482-36256504 CCTACTTTAAATTGGAAAGCCTG No data
Right 972163662 4:36256514-36256536 TTTCGGTGTGGTGAGTGAAATGG No data
972163658_972163661 -3 Left 972163658 4:36256482-36256504 CCTACTTTAAATTGGAAAGCCTG No data
Right 972163661 4:36256502-36256524 CTGTCTCGCTTGTTTCGGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972163658 Original CRISPR CAGGCTTTCCAATTTAAAGT AGG (reversed) Intergenic
No off target data available for this crispr