ID: 972168128

View in Genome Browser
Species Human (GRCh38)
Location 4:36312006-36312028
Sequence ATCTCTAATAGGAAGGAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 324
Summary {0: 1, 1: 0, 2: 0, 3: 27, 4: 296}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972168128 Original CRISPR ATCTCTAATAGGAAGGAAGA TGG Intronic
900739566 1:4322441-4322463 TTCTCTAAGAGCCAGGAAGAGGG - Intergenic
901909764 1:12446833-12446855 ATTTATACTAGGAAGAAAGATGG - Intronic
904993196 1:34610513-34610535 ATCTCTCTTAGGAGGCAAGATGG + Intergenic
905777439 1:40678104-40678126 ATCTCTAAAAAAAAGGAAGCAGG + Intergenic
907728811 1:57045853-57045875 TTCTATGATAGGCAGGAAGATGG + Intronic
908177666 1:61571914-61571936 ATCTGAAATAAGAAGGAAGAGGG + Intergenic
908879517 1:68715007-68715029 ATATGAAATAGGAAAGAAGATGG + Intergenic
910234470 1:85021310-85021332 GTCTCCAATGGGAAGGAACATGG - Intronic
910958164 1:92730354-92730376 ATCTCTAAAAGAAAGAAAGAAGG + Intronic
912503939 1:110142622-110142644 AGCTCTGATAGGAAGCTAGATGG + Intergenic
912961923 1:114203601-114203623 ATGTGAAATAGGGAGGAAGAGGG + Intergenic
913275804 1:117136743-117136765 ATCACTAATTGGAAGTATGAAGG + Intergenic
915009043 1:152667330-152667352 ATCTCTCAAGGGCAGGAAGAGGG + Intergenic
917745372 1:178001439-178001461 ATCTGTTAAAGAAAGGAAGAGGG - Intergenic
919714876 1:200765695-200765717 ATCTCTATTAGGGAGGATCAGGG + Intronic
919951597 1:202369237-202369259 ATCTCTAATAGGTTTTAAGATGG + Intronic
920398803 1:205664448-205664470 ATCTGGAACAGGAAGGAAGGAGG + Intronic
921474202 1:215586352-215586374 ATTTGTAATAGGAAGGTGGATGG + Intronic
922982220 1:229836762-229836784 ATCTCAAATAAGAGAGAAGATGG + Intergenic
923022576 1:230176138-230176160 ATCGTTGATTGGAAGGAAGAAGG + Intronic
923022585 1:230176203-230176225 ATCATTGATTGGAAGGAAGAAGG + Intronic
923508956 1:234632780-234632802 TTCTGTAATTGGAAGAAAGATGG + Intergenic
1063256956 10:4339186-4339208 ATCTCCAGCAGCAAGGAAGATGG + Intergenic
1063797957 10:9534353-9534375 ATTTCTAATTGGAATGAAGATGG + Intergenic
1064188835 10:13187731-13187753 TAATCTAATAGGAAGGAATAAGG - Intronic
1064745431 10:18474034-18474056 ATCTCTAATAGTTAAGATGATGG + Intronic
1065799790 10:29341746-29341768 ATCTCATATTGGAAGGCAGAAGG - Intergenic
1065862997 10:29887054-29887076 GTCTCTTATGGGAAGCAAGATGG - Intergenic
1065987490 10:30969723-30969745 ATGTTTAATAGGATGGAACATGG - Intronic
1067174422 10:43933284-43933306 ATTTCTACCAGGAATGAAGAAGG + Intergenic
1067779886 10:49193817-49193839 ATCTCTCAGAGCAAGGCAGAGGG + Intergenic
1068036381 10:51765090-51765112 GTGTGTATTAGGAAGGAAGATGG + Intronic
1069298828 10:66881153-66881175 GTCTCTAAAAGGAAGGAAACAGG + Intronic
1069314793 10:67083934-67083956 TTCTCTATTAGGAAGGGAGAGGG + Intronic
1072085670 10:92076943-92076965 ATCTGTAATAGCAAGGAAAAGGG + Intronic
1074956117 10:118391721-118391743 ATCTCTACAAGGCAGGAAGAAGG + Intergenic
1075938338 10:126363867-126363889 ATCTATATTAGGAAGGAAAGTGG - Intronic
1076249029 10:128970458-128970480 TTCTCTATTAGGAATGAGGAAGG - Intergenic
1077547897 11:3183806-3183828 GTGTCCACTAGGAAGGAAGAAGG - Intergenic
1077793208 11:5463503-5463525 ATCTCTGCTAGGAAGAATGAAGG - Intronic
1079065393 11:17286640-17286662 ATCTCTCTTATGAAAGAAGAGGG + Intronic
1079221838 11:18569883-18569905 ATCTGTAATAGGAAGGGACTTGG + Intronic
1082097598 11:48143885-48143907 GTCTCTAAAAGAAAGAAAGAGGG - Intronic
1082803557 11:57432070-57432092 ATTACTAATAGGAATGAAGATGG + Intergenic
1083591678 11:63899033-63899055 CTATCTGAAAGGAAGGAAGAAGG - Exonic
1086143387 11:83523873-83523895 GACTCTAATGGGCAGGAAGATGG - Intronic
1086176147 11:83893427-83893449 ATATCTGAGAGGCAGGAAGAAGG - Intronic
1088337463 11:108722474-108722496 TTCTCTTTTAGGAAGGGAGATGG + Intronic
1088437975 11:109836290-109836312 ATCCGTAATAGAAAGGAAGTAGG - Intergenic
1088529229 11:110790303-110790325 AACTCTAGTAGGAAAGTAGAGGG - Intergenic
1088928866 11:114328935-114328957 ATATCTAAGAGGCAGGAAAAGGG - Intergenic
1089455219 11:118621865-118621887 GTCTCTGATAGGAAGGACCAAGG + Intronic
1091162960 11:133442603-133442625 ATCTTTAATAAAAAGGAAGTAGG + Intronic
1092029349 12:5271155-5271177 ATCTCTAAAAAAAAAGAAGAAGG - Intergenic
1092520273 12:9265195-9265217 ATCTCTTATATGAAAGAAAATGG + Intergenic
1093115263 12:15202023-15202045 ATGTTGATTAGGAAGGAAGAAGG - Intronic
1095158023 12:38882205-38882227 ATATATAAGAGGAAGGCAGAGGG + Intronic
1095174070 12:39070207-39070229 ATTTATAATAGGAAAGAACAGGG - Intergenic
1095318967 12:40802248-40802270 ATCTATAACAGGAAGACAGAAGG + Intronic
1097879668 12:64675506-64675528 ATCTCTAAGAGGAGTGAAGGAGG + Intronic
1099978487 12:89571223-89571245 ACCTGTAAGAGGAAGAAAGATGG - Intergenic
1100094223 12:91011460-91011482 GACTATAATGGGAAGGAAGAGGG - Intergenic
1100289788 12:93202775-93202797 ATCTGTGGAAGGAAGGAAGAAGG + Intergenic
1100371947 12:93976468-93976490 AGTTCTGTTAGGAAGGAAGAAGG + Intergenic
1100431618 12:94535997-94536019 CTCTCTAAGAGAAAGGAGGATGG + Intergenic
1101030202 12:100650876-100650898 ATATCTATTAGGAGAGAAGAGGG - Intergenic
1101911123 12:108860735-108860757 AGCTCTAAGAGGAAGTGAGAAGG - Intronic
1102828640 12:115973597-115973619 GACTATAATAGGAAAGAAGAGGG - Intronic
1104020284 12:124987670-124987692 AACTCTGATAGGAGGTAAGACGG + Intronic
1104170495 12:126275776-126275798 CTCTCTAATGGCAAGGAAGCTGG + Intergenic
1106203385 13:27564744-27564766 ATCTCGAAGAGGCAGTAAGATGG - Intronic
1107626989 13:42298086-42298108 AATTGTGATAGGAAGGAAGATGG + Intronic
1108402920 13:50066760-50066782 ATATATAAAAGGAAGGAAAAAGG + Intergenic
1109132270 13:58602230-58602252 TTTTCTAATAGGAACAAAGAGGG + Intergenic
1109925326 13:69129556-69129578 AGCTAGAATAGTAAGGAAGATGG - Intergenic
1110467377 13:75817360-75817382 TTCTGTAATAGCAAGGAAAATGG - Intronic
1110478715 13:75948741-75948763 ATCTGTAATATGAAGGAAAAAGG + Intergenic
1111569910 13:90071000-90071022 ACCTCTAATGGGGAGGAAGCAGG - Intergenic
1112058487 13:95713792-95713814 TGCTCTCATAAGAAGGAAGAAGG - Intronic
1112187822 13:97144806-97144828 ATCTCAAATAGGAACAAATAAGG + Intergenic
1112546697 13:100377910-100377932 ATATAAAATAGGAAGGAACAAGG - Intronic
1112727904 13:102326598-102326620 AGCTCAAAAAGGAAGGAAGGAGG + Intronic
1113419443 13:110159122-110159144 CTCCCTGATAGGAAGTAAGATGG - Intronic
1113514873 13:110886508-110886530 ATAGCTACTAGGAATGAAGAAGG - Intronic
1113881826 13:113631197-113631219 ATCACTAAAAGGAAGTAAAAGGG + Intronic
1115185560 14:30684069-30684091 ATTACTTATAGGAAGGAAAAGGG + Intronic
1116466317 14:45236903-45236925 ATCTTTAATAGTAAGGAAATGGG + Intronic
1117544119 14:56777631-56777653 GTCTGTACTAGGAAAGAAGAAGG + Intergenic
1119676719 14:76561244-76561266 ATTTGTAAAAGGAGGGAAGAAGG + Intergenic
1120153603 14:81065409-81065431 ATATCTAAGAAGATGGAAGATGG + Intronic
1120223489 14:81763426-81763448 ATGTCAGATATGAAGGAAGATGG - Intergenic
1120388146 14:83871411-83871433 ATTTTAAATGGGAAGGAAGAAGG + Intergenic
1120573196 14:86147542-86147564 AGTTCTAAGAGTAAGGAAGAAGG + Intergenic
1122246502 14:100406933-100406955 ATCCCAAGAAGGAAGGAAGAAGG - Intronic
1126152956 15:45539640-45539662 CTCAATAATAGGAAGGGAGAAGG - Intergenic
1126544717 15:49860831-49860853 ATCTCTAAAAGAGAGGAAAAAGG - Intronic
1126683254 15:51224652-51224674 ATGACTAATTGGAAGGAAGCAGG - Intronic
1126853961 15:52819256-52819278 ATCTCTCATAGGAAGAAATGAGG - Intergenic
1128341409 15:66825039-66825061 ATCTTGAACAAGAAGGAAGAAGG + Intergenic
1128341664 15:66826553-66826575 ATCTTGAATGAGAAGGAAGAAGG - Intergenic
1129174972 15:73833285-73833307 ATCTGTGATAGGAGTGAAGATGG - Intergenic
1130033691 15:80339414-80339436 CTGTCTACTTGGAAGGAAGAAGG + Intergenic
1130182755 15:81647364-81647386 AGCACTAATAGGAAAGAAAAAGG - Intergenic
1130823895 15:87523921-87523943 TTTTCTTATAGGAAGAAAGATGG - Intergenic
1131089083 15:89606219-89606241 ATCTGTGATAGGGAGGAAAAAGG - Intronic
1131516715 15:93083218-93083240 AACTCTCATAGCATGGAAGAAGG + Intronic
1132041624 15:98529420-98529442 ACCTTTACCAGGAAGGAAGAGGG + Intergenic
1134470877 16:14524939-14524961 ATATCTAATAGGGAGGAATGGGG + Intronic
1135687201 16:24507393-24507415 GTCCCTAACAGGAAGTAAGACGG + Intergenic
1135929161 16:26721962-26721984 ATCTCAAAAAGAAAGGAAGGAGG + Intergenic
1136610000 16:31360371-31360393 ATCACTGATGGGAAGAAAGAAGG + Exonic
1138291487 16:55851397-55851419 ATCTCTAATAATTAGGAAAATGG + Intronic
1138807925 16:60113303-60113325 ACCTCAAAAAGAAAGGAAGATGG + Intergenic
1141102216 16:81206098-81206120 ATCTTTAATGTAAAGGAAGATGG + Intergenic
1141355452 16:83341246-83341268 ATTTCAATTAGGAAGAAAGAAGG + Intronic
1141740787 16:85891296-85891318 ATCTCTAAAAGGCAGTAAGTTGG - Intergenic
1142014553 16:87737915-87737937 ATCTCTGATAGGACGGAGGTGGG - Intronic
1144993084 17:19247489-19247511 ATCCCTAAGTGGAAGGCAGATGG + Intronic
1146584676 17:34071908-34071930 ATGTCTAAGTGGAAGGATGAAGG + Intronic
1147848562 17:43423137-43423159 ATCTCTTTTGGGAAGGAACAAGG - Intergenic
1148299076 17:46530442-46530464 ATCTGGAATAGGAAAGAGGAGGG + Intronic
1148735556 17:49862857-49862879 GCCTGAAATAGGAAGGAAGAGGG - Intergenic
1149974112 17:61248898-61248920 ATCTTTAAGAGCAAAGAAGAAGG - Intronic
1150163965 17:62923927-62923949 TAATCTAATAGGAAGGCAGAAGG - Intergenic
1151203273 17:72484713-72484735 ATCTCGAAAAGAAAGAAAGAAGG + Intergenic
1151449749 17:74191277-74191299 TTTTCTAATAGGGAGGGAGAAGG - Intergenic
1153623842 18:7004853-7004875 AGCTCAAAGAGCAAGGAAGAAGG + Intronic
1153649905 18:7230660-7230682 ATCTCTAAAAAGAAGTAAAATGG - Intergenic
1153864319 18:9249590-9249612 ATCTGTTGTGGGAAGGAAGACGG - Intronic
1155326980 18:24674112-24674134 TACTCTACTAAGAAGGAAGAAGG - Intergenic
1155685092 18:28538739-28538761 GTCTCCAAAAGGAAGAAAGATGG - Intergenic
1155868914 18:31001198-31001220 ATATCTAAAAGAAAGGGAGAGGG - Intronic
1155870894 18:31026708-31026730 AATTCTAATACTAAGGAAGATGG - Intronic
1156501212 18:37559753-37559775 ATCTATATCAGGAGGGAAGAGGG - Intronic
1156646557 18:39169382-39169404 ATTCCAAATAGGAAGGAAGAAGG - Intergenic
1156811103 18:41252800-41252822 ATGTGTAATGAGAAGGAAGAAGG + Intergenic
1156989818 18:43395518-43395540 ACCTCAAATAAGAAGGAAGTTGG - Intergenic
1157929873 18:51809825-51809847 ATTGCTAATTGGTAGGAAGAGGG + Intergenic
1158210587 18:55045144-55045166 ATCTATAATAGGTAGGGAGATGG + Intergenic
1160550229 18:79690149-79690171 ATCTGTAGAAGGAAGGGAGAAGG + Intronic
1161521246 19:4724529-4724551 ATGTCTAAAAGGCAGGAGGAAGG + Intronic
1161848412 19:6725583-6725605 ATCAGTAATAGGGTGGAAGAAGG - Intronic
1161860691 19:6796065-6796087 ATCTCTAACAGGCAGCAAGAAGG - Intronic
1162981622 19:14244016-14244038 ATCTCTAGAAGGAAGGGAGTTGG + Intergenic
1164603465 19:29579107-29579129 TTCTCTCATTGGAAGGAAGGAGG - Intergenic
1164817886 19:31220224-31220246 AACTTTAAGAGGAAGGAACAGGG + Intergenic
1165341180 19:35213324-35213346 ATATCAAAGAAGAAGGAAGAGGG + Intergenic
1167983152 19:53293111-53293133 ATGTCCAGTAGGCAGGAAGAAGG - Intergenic
1168543544 19:57231808-57231830 ATCTGGAAAAGGAAGGAAGGTGG + Intronic
925776361 2:7339806-7339828 ATCTCTGAAAGGAAGGAAGCTGG + Intergenic
928439871 2:31283450-31283472 ATATCTAACAGGGAGAAAGATGG - Intergenic
929366570 2:41165133-41165155 AACTTTAATAGTCAGGAAGAAGG - Intergenic
930056983 2:47259718-47259740 ATCTCTAGTGGAAAGGAATAGGG + Intergenic
930155569 2:48104338-48104360 ATCTCTAGAGGGAAGGAAGGAGG + Intergenic
930892850 2:56411366-56411388 ATCCCTAATAGGGAGGCAGAGGG + Intergenic
931933173 2:67164507-67164529 ATGTCTACAAGCAAGGAAGAGGG + Intergenic
932311892 2:70749511-70749533 TTCCCTGATAGGGAGGAAGAAGG - Intronic
933022633 2:77213753-77213775 ATCTCTGAAAGGAAGGGAGCTGG - Intronic
933428342 2:82142009-82142031 ATTTCTTATATGAAGGAAAATGG + Intergenic
933825183 2:86153647-86153669 ATATCTAAAAGGAAACAAGAAGG + Intronic
934046613 2:88178035-88178057 ATCTACACTTGGAAGGAAGAGGG - Intronic
936436705 2:112513856-112513878 ATCCCTAGAAGGAAGGCAGAAGG + Intronic
936455826 2:112673575-112673597 ATCACTAATAGCAAGGAATTTGG + Intergenic
940160739 2:150710613-150710635 AGCTCTAATTGGAAGGTTGATGG - Intergenic
940171811 2:150836648-150836670 ATCTCTACCAGGAAGGACAAAGG + Intergenic
940854218 2:158717192-158717214 AGCTCTGAGAGGAAGGAACAAGG + Intergenic
941952212 2:171167273-171167295 CACTCTGATAAGAAGGAAGAAGG - Intronic
942161802 2:173196711-173196733 ATTTCTAATAGGAACGTAGATGG - Intronic
943223230 2:185136714-185136736 ATCTCTTAGAGGAAACAAGATGG - Intergenic
943290010 2:186057905-186057927 ATCTTTAGTGAGAAGGAAGATGG + Intergenic
943975194 2:194467370-194467392 TTCTCTAATAGAAAAGAAAAAGG - Intergenic
944055409 2:195517407-195517429 ATGTGTAATAGGCAGGAAAATGG - Intergenic
945816253 2:214608571-214608593 AACTCTAATAGGAAATAACATGG - Intergenic
947946027 2:234103003-234103025 AACCCTGATAGGTAGGAAGATGG - Intergenic
948358134 2:237397095-237397117 ATATATAAAAGGAAGGAAGGAGG + Intronic
1169916718 20:10690689-10690711 ATCCCAAATAGGAATTAAGATGG - Intergenic
1170409687 20:16075300-16075322 AATTCTATTAGCAAGGAAGAAGG + Intergenic
1170576666 20:17668200-17668222 AGCTCTACCAGGAAGGAATAGGG - Intronic
1170898012 20:20434009-20434031 CTCTGTAGTAGGGAGGAAGAGGG + Intronic
1171396380 20:24836462-24836484 AGCTCTATCAGCAAGGAAGAAGG - Intergenic
1173361877 20:42352059-42352081 ATCTCTGCTAGAAAGGAAAAAGG - Intronic
1174894215 20:54431282-54431304 ATCACTAATGGGATGGTAGAAGG - Intergenic
1174894982 20:54438858-54438880 ATCTCCTATATAAAGGAAGATGG - Intergenic
1174988617 20:55484486-55484508 ATCTCCAAAAGGCAGGAACATGG - Intergenic
1175983168 20:62751537-62751559 TTCTCTAAAAGGTAGGAAAACGG + Intronic
1177135764 21:17304148-17304170 ATCTCTGATAGGAACAAAGCAGG + Intergenic
1177210720 21:18067694-18067716 TTCTCAAATATGAAGGAAAAAGG - Intronic
1179429104 21:41306899-41306921 ATGTCAAATGGGAAGGAGGAAGG - Intronic
1183275772 22:36896593-36896615 ATCTCAAAAAGAAAGAAAGAAGG + Intergenic
951093485 3:18601507-18601529 ATATCAAATTGGAAGGAAGAGGG + Intergenic
951804452 3:26629268-26629290 ACCTAAAATTGGAAGGAAGAAGG - Intronic
952036690 3:29211383-29211405 AGCTCTCCTGGGAAGGAAGATGG - Intergenic
953956756 3:47237396-47237418 ATCTCTAACAAGAAGGTAGCTGG - Intronic
954257403 3:49416266-49416288 ATATCCAACAGGAAGGAAGTAGG - Exonic
956063585 3:65373673-65373695 GTTCCTAATAGGAAGGATGAAGG - Intronic
957385158 3:79486873-79486895 CTCTCTACTAGGAAGGACAAAGG + Intronic
958021112 3:87997296-87997318 ATCTCTAATCTGAAGAAAGCAGG - Intergenic
959094356 3:101937053-101937075 ATCTCTAAGGGGAAGGAATCAGG + Intergenic
960179978 3:114564411-114564433 ATTTCAAATAGCAAGCAAGATGG + Intronic
960253666 3:115486963-115486985 ATCAATAATAGGAAGTGAGAGGG + Intergenic
960718482 3:120601800-120601822 AACTCTAATGGGAATGCAGATGG - Intronic
961036219 3:123643760-123643782 AGCTCTCATAGGAAGCAAGAAGG + Intronic
961091651 3:124118050-124118072 ATCCCTAAGAGGAGGCAAGATGG - Intronic
962003944 3:131329358-131329380 AAGTCAAATAGGAAGGAATATGG - Intronic
962084337 3:132174370-132174392 ATCTTTGATAGGTAGGAACATGG - Intronic
962935523 3:140077059-140077081 AGCTCTAAGATGAATGAAGAAGG + Intronic
964339193 3:155690471-155690493 ATCTATAATAGCAAGGACTAGGG - Intronic
965119159 3:164529009-164529031 GACTCAAATAGGAGGGAAGAAGG - Intergenic
965768202 3:172153635-172153657 CTTTCTTATAGGAAGGAAGGAGG + Intronic
965848397 3:172991474-172991496 ATATCTCATAGGAAGAAAAAAGG - Intronic
966926284 3:184646637-184646659 ATCTCTAGAAGGAAGGAGAAGGG + Intronic
967144523 3:186595212-186595234 ATCTTTAATATAAAGGAAGAGGG - Intronic
967474759 3:189903453-189903475 ATCTCTAAGAGGAAAGAGGCTGG + Intergenic
969063650 4:4460082-4460104 ATCTTTACGGGGAAGGAAGAAGG - Intronic
969866681 4:10080858-10080880 ATCTGTAAGAGGAACCAAGATGG + Intronic
970144997 4:13026703-13026725 ATCTATAAAAGCAAGAAAGACGG + Intergenic
970925518 4:21447168-21447190 ATCTTTAACAGAAAGGTAGAAGG + Intronic
970963707 4:21903225-21903247 ATCTCAAATTGAGAGGAAGATGG - Intronic
971329102 4:25667673-25667695 ATCTGCAATAGGGAGGAAGGAGG + Intronic
972112635 4:35584455-35584477 ATCTCTGATAAGAAGGCATATGG + Intergenic
972168128 4:36312006-36312028 ATCTCTAATAGGAAGGAAGATGG + Intronic
972191069 4:36591708-36591730 ATATATAATAAGAAGCAAGAAGG + Intergenic
972228390 4:37041727-37041749 GACTCTAAGAGGAAGGAAGTAGG - Intergenic
972331955 4:38072063-38072085 ATCTCACAAAGGAAGGAACAGGG - Intronic
973149309 4:46867311-46867333 ATCTCTAATGGGAAAAAATAAGG + Intronic
973609780 4:52624696-52624718 ATCTCTAATAGGATGGTATTTGG + Intronic
976874441 4:89836827-89836849 ATATTTAATAGGAAAGAAGAAGG + Intronic
977169581 4:93744168-93744190 AACTCTAATAGTAATGAACAAGG + Intronic
977416431 4:96738963-96738985 ATAACTAATAGTAATGAAGAGGG + Intergenic
977568957 4:98610476-98610498 ACCTCAAATAGGAGGGAAGTTGG - Intronic
980159911 4:129148265-129148287 ATTTCCAAAAGGGAGGAAGAAGG + Intergenic
983384499 4:167042029-167042051 AATTCTAATAGGAGGGAAAATGG - Intronic
983465803 4:168087896-168087918 ATCTTTCATTGGAAGGAGGACGG + Intergenic
985382936 4:189414292-189414314 GTCTAAAAGAGGAAGGAAGAAGG + Intergenic
987471545 5:18336450-18336472 GTCTCCAGTAGTAAGGAAGAAGG + Intergenic
988288509 5:29253512-29253534 ATATCAGAAAGGAAGGAAGAAGG + Intergenic
988327038 5:29782850-29782872 ATCTCTATTAAGAAGAAGGAAGG + Intergenic
989785967 5:45329961-45329983 ATATGTAATTGGAAAGAAGATGG - Intronic
990377178 5:55182937-55182959 ATCACTAATACGAAGAAATAAGG + Intergenic
990956758 5:61348469-61348491 ATCTTTAACAGGAAGTATGAAGG - Intronic
991393179 5:66171956-66171978 ATCTCTAAAATAAAGGAAAAGGG - Intronic
993133299 5:83926168-83926190 ATGTGTGATAGGAAGGGAGAGGG + Intergenic
993759384 5:91774232-91774254 ATCCATAAGAGGAAGGATGATGG - Intergenic
993909899 5:93668445-93668467 ATCTATAAAAGCAAGGCAGATGG + Intronic
994049194 5:95343563-95343585 ATCTCAAACAGGGAGGAATAAGG + Intergenic
995006272 5:107199769-107199791 ATATATAAAAGGAAGGAAGAGGG + Intergenic
998069987 5:139190182-139190204 ATCTCTAAGAGAAAGAGAGAAGG - Intronic
998793756 5:145794620-145794642 ATCTGTAAGAGGAAGGAAGCAGG + Intronic
999512063 5:152262710-152262732 ATTGCTTAAAGGAAGGAAGAGGG + Intergenic
999704027 5:154255212-154255234 ATCTCTAATAATTAGGAAAATGG + Intronic
1000292673 5:159885286-159885308 GGTTCTATTAGGAAGGAAGAAGG - Intergenic
1003001151 6:2335017-2335039 ACCTCTCATATGAAGGAACAGGG + Intergenic
1003993578 6:11514113-11514135 ATCACTAACAGGAAGGCAGGAGG + Intergenic
1004297635 6:14428313-14428335 ATTTCTAATAAAATGGAAGATGG + Intergenic
1004554453 6:16682114-16682136 ATCTTTAATAAGAAAGAAGAAGG - Intronic
1004739870 6:18448318-18448340 ATCTCTATCAGGAAAGAAGGTGG + Intronic
1006051965 6:31352240-31352262 ATGTCTACTAGGAAGGCAGGTGG - Intronic
1007675646 6:43592338-43592360 AGCTCTTATAGGAGGCAAGATGG - Intronic
1008090295 6:47286688-47286710 ATCTTTAACAGGAATGATGATGG - Intronic
1010253292 6:73730708-73730730 TCCTCTAATAGGAAAGAAGGTGG + Intronic
1010288195 6:74104170-74104192 ATCTCTAAGAGGCTGGAAAAGGG - Intergenic
1010517712 6:76793134-76793156 ATCTTTGATAGAGAGGAAGAAGG + Intergenic
1011011844 6:82711925-82711947 GACTCTGTTAGGAAGGAAGAAGG - Intergenic
1011283668 6:85702268-85702290 GTTTCAAAAAGGAAGGAAGAAGG - Intergenic
1013143735 6:107366212-107366234 ATCTCAAATAGAAAGAAATAGGG + Intronic
1013802506 6:113963928-113963950 ATATCTAATTTGAAGGAATATGG - Intronic
1015366166 6:132400831-132400853 ATCCCTGATGGGAAGGGAGAAGG - Intronic
1015553003 6:134431612-134431634 ATTTATAATAGGGAGTAAGAAGG + Intergenic
1018198087 6:161372351-161372373 ATCACTAATAGGATGTGAGAGGG + Intronic
1018663774 6:166114359-166114381 GTTTCTAATAGGAATGAAGGAGG + Intergenic
1020407447 7:7853762-7853784 ATCTAAATTAGGAAGGAAGAAGG - Intronic
1020948228 7:14643240-14643262 ATCTCTGATGGGAATGTAGATGG - Intronic
1022009309 7:26294800-26294822 ATCTGTAAAAAGAAAGAAGAAGG - Intronic
1022844171 7:34193199-34193221 ATCTCTAACATGAAAGAGGAGGG + Intergenic
1023182500 7:37499156-37499178 AGCTTTATTAGGAAGGAAGACGG + Intergenic
1023193456 7:37608750-37608772 ATCTCTAATAATAGGAAAGAAGG - Intergenic
1023753766 7:43396793-43396815 ATCTGTAAAAAGAAGGAAAATGG - Exonic
1026214471 7:68336099-68336121 ATCTCAAAAAGAAAGAAAGAAGG - Intergenic
1027461828 7:78463870-78463892 ATAGATAATAGGAAGGAAGGGGG + Intronic
1028340598 7:89715381-89715403 ATTTCTGATGGGAAGGCAGATGG - Intergenic
1028831986 7:95338225-95338247 ATAGCTAATTGGAAGGAAGCTGG - Intergenic
1029088060 7:98026716-98026738 ATCTTTAAAAGGAAGGGGGAAGG - Intergenic
1031530346 7:122867885-122867907 ATCTCACATTGGAAGGAAGCTGG + Intronic
1033048621 7:137984224-137984246 GTGTCTGATAGTAAGGAAGACGG - Intronic
1033771796 7:144560528-144560550 ATCTTCAATAGCAAGCAAGAGGG - Intronic
1035048863 7:155986821-155986843 GTCTCTAAAAGGATGGAAAATGG + Intergenic
1036280503 8:7396165-7396187 ATCTCGACTGGGAAGGAAGATGG + Intergenic
1036340966 8:7915405-7915427 ATCTCGACTGGGAAGGAAGATGG - Intergenic
1037348978 8:17929075-17929097 ATGTATTATTGGAAGGAAGAGGG - Intronic
1038065435 8:23958845-23958867 CTATCTACAAGGAAGGAAGAAGG - Intergenic
1042576499 8:70226240-70226262 GTTTATAATAAGAAGGAAGAGGG + Intronic
1042603084 8:70518798-70518820 ATCTCAATTGGAAAGGAAGAAGG - Intergenic
1044872177 8:96630183-96630205 ATTACTAACAGGAAGAAAGATGG - Intergenic
1045308079 8:100976240-100976262 ATCTCAAAAAGAAAGAAAGAAGG - Intergenic
1046583846 8:116126726-116126748 ATATCTAATATGATGGGAGAAGG + Intergenic
1046750384 8:117920574-117920596 AACTCTCCTGGGAAGGAAGAGGG + Intronic
1047395951 8:124499111-124499133 ATCTGTAATAGCAAAGAAAAAGG - Intronic
1048054789 8:130853051-130853073 ATCTCTCCAAGGAAGGAGGAAGG + Intronic
1050247914 9:3710884-3710906 ACCTATAATAGGAAAGAAGAAGG + Intergenic
1052761168 9:32593084-32593106 ATCTATATTATGAAGGATGATGG - Intergenic
1054811885 9:69441635-69441657 ATCTCTAACTGGCAGAAAGAAGG - Intronic
1055348742 9:75363198-75363220 ATCTCAGATAGCAAGGAAAATGG - Intergenic
1055490553 9:76800398-76800420 GTCTCTAATAGAAAGCTAGAGGG - Intronic
1055642775 9:78333432-78333454 AGCTCTAAGAGGAGGGAGGAGGG - Intergenic
1057535066 9:95893942-95893964 ATCTGTATTAGGAAAGAAGAGGG - Intronic
1058892237 9:109371039-109371061 ACCCCTGAGAGGAAGGAAGAGGG + Intergenic
1060465524 9:123901381-123901403 ATTTTTAATAGGAGGGTAGAGGG - Intronic
1062090625 9:134676881-134676903 AGCGCTCAAAGGAAGGAAGAAGG - Intronic
1186616550 X:11194531-11194553 ATCTCAAATTGGAAAAAAGAAGG - Intronic
1187887590 X:23904179-23904201 AGTTCTTTTAGGAAGGAAGAGGG - Intronic
1189219625 X:39360203-39360225 ATCTCTCAGATGAAGGGAGAGGG + Intergenic
1189967710 X:46391583-46391605 ATATTTAATTGGAAGAAAGAAGG - Intergenic
1190396174 X:49987565-49987587 GTATCTTATAGGAAGGAATATGG - Intronic
1191688480 X:63916328-63916350 ATTTCTAATTAGAAGGAAGCTGG + Intergenic
1191713755 X:64179660-64179682 ATATCTAAGAGGGAGCAAGAAGG + Intergenic
1192149529 X:68703574-68703596 ATCTCTGATAGAAAGGAAATGGG - Intronic
1192505428 X:71678743-71678765 TTCTCTAAAAGGAAGGCAGGAGG - Intergenic
1192560908 X:72127370-72127392 ATCTGGGAAAGGAAGGAAGAGGG + Intronic
1195462202 X:105140184-105140206 AGTTCTAATAGGAAGGTAAAAGG - Intronic
1196414251 X:115454333-115454355 ATCTAAAATGGGAAGCAAGAAGG - Intergenic
1197514346 X:127406399-127406421 ATCTATAATAGAAAGGAAAGTGG - Intergenic
1199437271 X:147826855-147826877 AAGTATAATGGGAAGGAAGAGGG - Intergenic
1199717860 X:150519036-150519058 ATTTCTAAAAAGAAAGAAGAAGG + Intergenic
1202582948 Y:26401497-26401519 ATCTCTAATAGGTTTTAAGATGG - Intergenic