ID: 972168716

View in Genome Browser
Species Human (GRCh38)
Location 4:36318907-36318929
Sequence GAAAATGCACAGAAGAGGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 827
Summary {0: 1, 1: 0, 2: 12, 3: 92, 4: 722}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972168716_972168722 26 Left 972168716 4:36318907-36318929 CCTGGCCTCTTCTGTGCATTTTC 0: 1
1: 0
2: 12
3: 92
4: 722
Right 972168722 4:36318956-36318978 ACGGCCGTTACTTACGCATGCGG 0: 1
1: 0
2: 0
3: 0
4: 10
972168716_972168720 7 Left 972168716 4:36318907-36318929 CCTGGCCTCTTCTGTGCATTTTC 0: 1
1: 0
2: 12
3: 92
4: 722
Right 972168720 4:36318937-36318959 CCATAAGACTTTGCACCATACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972168716 Original CRISPR GAAAATGCACAGAAGAGGCC AGG (reversed) Intronic
901196223 1:7441487-7441509 GAAAATGCAGAGCCGAGGCCAGG + Intronic
901498571 1:9637232-9637254 AATAATCCATAGAAGAGGCCAGG + Intergenic
901575988 1:10201290-10201312 GAAAATACACAGCAGAGTCATGG - Intergenic
902164774 1:14561341-14561363 GAAAAGGCATTGAGGAGGCCTGG + Intergenic
902415144 1:16234102-16234124 TAAATTACACAGAGGAGGCCTGG + Intronic
903198590 1:21713403-21713425 GAAATTGTACATAAGAGGCCGGG - Intronic
903329059 1:22587863-22587885 GAAAATGCACAGATCTGGGCAGG - Intronic
904167333 1:28566019-28566041 GAAAATGCTCAGCACAGGCTGGG + Intronic
904227112 1:29031102-29031124 TAAAATGCTAACAAGAGGCCGGG - Intronic
905135421 1:35795576-35795598 GAAAAAGAACAGTTGAGGCCGGG + Intergenic
905184600 1:36187428-36187450 GAAAAAAAAAAGAAGAGGCCTGG - Intergenic
905397366 1:37675463-37675485 GAAAATGATAAGAAGGGGCCAGG + Intergenic
905638233 1:39570303-39570325 GTAAATGCATAGAAAAGGTCTGG + Intronic
905654689 1:39678578-39678600 AGAAAGGGACAGAAGAGGCCTGG - Intergenic
906423968 1:45693873-45693895 GAAAAAGGACATAAGAGACCTGG + Exonic
906513046 1:46422496-46422518 GTAAAAGCACAGACGAGGCCAGG - Intergenic
906903071 1:49858719-49858741 GAAAATGCATGAAAAAGGCCAGG + Intronic
906972799 1:50534567-50534589 AAAAATCAACAGAAGAGGCTGGG - Intronic
907306166 1:53514245-53514267 CCAAATGCACAGATGAGGCAAGG + Intronic
907373797 1:54019488-54019510 GAGAATGGCCAGAGGAGGCCAGG + Intergenic
907480118 1:54739888-54739910 AAAGATGTACAGAATAGGCCGGG + Intronic
907821244 1:57971783-57971805 TGAAATCCACAGAAGAGGGCAGG + Intronic
909615911 1:77607628-77607650 GAAAATACAGAGAGGAGGCCGGG + Intronic
909932525 1:81513925-81513947 GAAGATTCACAGAAGATGACAGG - Intronic
909995765 1:82277111-82277133 ATAATTGCACAAAAGAGGCCAGG - Intergenic
910046701 1:82926151-82926173 GAAATTGAACAGAAGGGGCCAGG - Intergenic
910443238 1:87274426-87274448 GATAATGCAAAAAAGGGGCCTGG - Intergenic
911267361 1:95758437-95758459 TAAAATGGACAGAAGAGGATAGG + Intergenic
911353582 1:96787315-96787337 AAAAATGAACAAAAGCGGCCAGG - Intronic
911614610 1:99995446-99995468 GAAAATACACAAAAAGGGCCAGG - Intronic
911875402 1:103155799-103155821 TAGAATGCACAGATTAGGCCGGG - Intergenic
912647860 1:111412053-111412075 GTAACTGCACTGAAGAGGCTAGG - Intergenic
913013395 1:114708406-114708428 GAAAATGTGCAGAAGAGGATAGG + Intronic
913485424 1:119328958-119328980 TAATATGCACAGAAGAGCACTGG - Intergenic
913552585 1:119930481-119930503 AAAAAGGCACAAAAGAGGCTGGG + Intronic
913711698 1:121490720-121490742 GAAAATGTATAGCACAGGCCGGG + Intergenic
914925607 1:151883760-151883782 TAAAATGCACAGTTAAGGCCAGG - Intronic
914986650 1:152462997-152463019 GAAAATGCAAAGAATTGGTCGGG - Intergenic
915037942 1:152944172-152944194 GAGAATTGACAGAAGAGGCCGGG + Intergenic
915174707 1:154005144-154005166 GAAAAAGAAAAGAGGAGGCCGGG - Intronic
915217092 1:154347643-154347665 GAAAATGGAAACAACAGGCCGGG + Intronic
915526379 1:156478823-156478845 CATAAGCCACAGAAGAGGCCGGG - Intronic
915833299 1:159151663-159151685 AAAAATCCATAGAAGTGGCCGGG + Intergenic
916277129 1:163007238-163007260 GAAAATGCAGAAAACAGGCCGGG + Intergenic
916728547 1:167545529-167545551 TTAAAAGCACAGAAAAGGCCAGG + Intronic
916791819 1:168131967-168131989 TAAAATGCACATAACTGGCCAGG + Intronic
917757024 1:178112022-178112044 TAAAATTGACAAAAGAGGCCAGG - Intronic
918093918 1:181318844-181318866 GAAAGAGCACAGAGGAAGCCAGG + Intergenic
918343911 1:183590113-183590135 ACAAATGCACAGAGGAGGCCCGG + Intronic
918619668 1:186588636-186588658 CAAAATTCACATAAGAGGCTGGG + Intergenic
918642037 1:186853308-186853330 GAAAAAGCAGTGAAAAGGCCTGG + Intronic
919113800 1:193255429-193255451 CAGAATGAACAGAACAGGCCAGG - Intergenic
920121728 1:203663897-203663919 GAAATTGGAGAGAAGAGGCTGGG - Intronic
920199659 1:204251799-204251821 GAAAGGCCACAGAAGGGGCCGGG + Intronic
920260464 1:204685026-204685048 GAGAATGCCCAGAAGCGGCCAGG - Intronic
920331229 1:205210196-205210218 GAAAAGACCCTGAAGAGGCCGGG - Intronic
920836511 1:209515649-209515671 GAAAATGAATAGAATAAGCCAGG - Intergenic
920926670 1:210348082-210348104 AGAAATGTACAGATGAGGCCTGG + Intronic
921510917 1:216028090-216028112 AAAGATTCACAGAAGTGGCCGGG + Intronic
921861599 1:220047295-220047317 AAAAAATCACAGCAGAGGCCGGG + Intergenic
922243076 1:223769414-223769436 AAAACTTCACAGAAGTGGCCAGG - Intronic
922771524 1:228186538-228186560 GAAAAAACATAGAAGAGGCTGGG - Intergenic
923053869 1:230410095-230410117 GCAAATGCAAAGAAGAAGGCAGG + Intronic
923619886 1:235569859-235569881 GAATATAGGCAGAAGAGGCCAGG - Intronic
923650005 1:235865327-235865349 GAAAAAGCACGGAAGAGGGAGGG - Intronic
923665762 1:235997127-235997149 AAAAAAGCAGAGAGGAGGCCAGG - Intronic
924054150 1:240108738-240108760 AAAAATGCACAGAAGGGGCCTGG + Intronic
924363365 1:243264317-243264339 GAAAATGGACAATACAGGCCAGG + Intronic
924514345 1:244753634-244753656 AAAAATGGAGAGAGGAGGCCAGG - Intergenic
924532131 1:244902326-244902348 TAAAATACACAAAACAGGCCGGG - Intergenic
924669129 1:246105229-246105251 TAAAATGCACAGATGGGCCCTGG + Intronic
1063318870 10:5033600-5033622 CAAAAAGTACAGAAGAGGCAGGG + Intronic
1063364542 10:5481756-5481778 GAAAAAGCACGGAAGAGGAACGG - Intergenic
1063512194 10:6656285-6656307 GCAAATGAACAGAAGATCCCTGG + Intergenic
1063631869 10:7741471-7741493 GTAAAAACACAGAACAGGCCAGG - Intronic
1064101768 10:12470358-12470380 GACTATGCACAGAAAAGGTCTGG - Intronic
1064332508 10:14406908-14406930 TGAAAAGCACAGAGGAGGCCAGG - Intronic
1064748016 10:18496913-18496935 AGAAATACATAGAAGAGGCCAGG + Intronic
1065030440 10:21580683-21580705 GAAAATACACAAAATAGGACGGG - Intronic
1065495866 10:26327547-26327569 GAAAAATCACAGAAGAGGTTTGG - Intergenic
1065847149 10:29754960-29754982 AAAAATGAGCAAAAGAGGCCTGG + Intergenic
1065933741 10:30501918-30501940 GAAAAATCACAGAAGAAGCTGGG - Intergenic
1067020257 10:42790556-42790578 TAAAATAGACTGAAGAGGCCGGG + Intronic
1067115012 10:43428725-43428747 TAATATGTATAGAAGAGGCCGGG - Intergenic
1067126331 10:43518712-43518734 GAAGATGCATAGAAGAGCCCTGG - Intergenic
1067250021 10:44578279-44578301 GGAAATGCACAGATGGGTCCAGG + Intergenic
1067280333 10:44866095-44866117 GAAAATTCAGAGCATAGGCCAGG + Intergenic
1067934490 10:50597715-50597737 TAAAATTCACAGAACTGGCCGGG + Intronic
1068170081 10:53381767-53381789 TAAAATGCAGAGCTGAGGCCGGG - Intergenic
1068352648 10:55869090-55869112 TAAAATGGACATGAGAGGCCGGG - Intergenic
1068875817 10:61995672-61995694 TAAACTGCAAAGAAGAGACCTGG + Intronic
1068900209 10:62259845-62259867 GAAAAATTACAAAAGAGGCCGGG - Intronic
1069063261 10:63916081-63916103 GAAAATCCACAGAAGGGGCCTGG - Intergenic
1069763696 10:70835440-70835462 AGAAATGCCAAGAAGAGGCCGGG + Intronic
1070147327 10:73784518-73784540 GAAAATGCAAAGAATTAGCCAGG - Intergenic
1070264632 10:74890341-74890363 ACAAATGCACACAGGAGGCCGGG + Intronic
1070353881 10:75620145-75620167 GAACATTCACAGACCAGGCCTGG + Intronic
1070441584 10:76451498-76451520 AAAAATGCAAATCAGAGGCCGGG - Intronic
1071148077 10:82598752-82598774 GAAAATGATGAGAAGAGGCCGGG + Intronic
1071311870 10:84350438-84350460 AAAAATGCACAGAACAGACCTGG - Intronic
1073029758 10:100516298-100516320 GAGAAGGAACAGAAGAGGGCTGG + Intronic
1073548430 10:104374162-104374184 AAAAATCCACAAAAGAGGTCGGG + Intronic
1073549486 10:104384664-104384686 GAAAATGCAGAGAAAAGGTTTGG + Intronic
1073641188 10:105254196-105254218 GAAAACGCAGAGGAGAGGGCTGG + Intronic
1073764403 10:106666133-106666155 AAAAATACATAGAAGTGGCCGGG - Intronic
1075142344 10:119850452-119850474 AAAACTGCAAAGAACAGGCCAGG + Intronic
1075740929 10:124696020-124696042 TAAAACACACAGAAGAGTCCCGG + Intronic
1075762610 10:124868320-124868342 GAAAAAGCACTGAACAGTCCTGG + Intergenic
1075776401 10:124991703-124991725 TACAATGCACAGGACAGGCCAGG + Intronic
1076065808 10:127447084-127447106 GAGCAGGGACAGAAGAGGCCGGG + Intronic
1076883048 10:133248724-133248746 GAAGAGGCCCAGAGGAGGCCAGG + Intergenic
1077257335 11:1592563-1592585 GAAAATCAACAGAAGAGGGCAGG + Intergenic
1077265508 11:1647088-1647110 GAAAATGCAAAGAACCGGCTGGG - Intergenic
1077359519 11:2134455-2134477 GAGAGGGCACAGGAGAGGCCAGG + Intronic
1077665089 11:4101075-4101097 GAAAAAGCACAGAAGGGGAAGGG + Intronic
1078181219 11:9012813-9012835 AAAAATGGACAGAGGAGGCTGGG - Intergenic
1078461547 11:11518916-11518938 GAAAGGGGACAGAAGAAGCCTGG - Intronic
1078673671 11:13389102-13389124 GAAAAAGTAAAGAAAAGGCCTGG - Exonic
1078852469 11:15177363-15177385 TAAAAGGCAGAGGAGAGGCCTGG + Intronic
1078869317 11:15328824-15328846 GAAAAGGCAGAGTTGAGGCCTGG - Intergenic
1079016896 11:16876493-16876515 GAACATGGACAGAAGATGGCAGG + Intronic
1081719942 11:45281360-45281382 GGATATGGACAGAAGGGGCCTGG + Intronic
1081838084 11:46174412-46174434 AGAAATACAGAGAAGAGGCCGGG - Intergenic
1082696005 11:56365506-56365528 AAAAATGCACAAAACATGCCAGG + Intergenic
1082884249 11:58066829-58066851 GGTGATGCACAGGAGAGGCCGGG + Intronic
1083952346 11:65963864-65963886 GAAGGTGCACAGAAGAGGCAGGG + Intronic
1084070707 11:66732350-66732372 GGAAATGGAGAAAAGAGGCCGGG + Intergenic
1084162879 11:67359839-67359861 GGAAATTGACAGAAAAGGCCAGG - Intronic
1084520664 11:69660720-69660742 GAAAACACACACAAGCGGCCGGG - Intronic
1084763982 11:71295513-71295535 AAAGATGCACTGAAGAGGGCAGG - Intergenic
1085053047 11:73389491-73389513 GAAACTGGGCAAAAGAGGCCTGG + Intronic
1086358290 11:86029132-86029154 AATAATGCACAGAACAGGCTGGG - Intronic
1086863405 11:91951509-91951531 GATAATGCAGAAAAGTGGCCAGG + Intergenic
1086876551 11:92103368-92103390 TAAAATGCACAGAGGATGCAGGG - Intergenic
1086918056 11:92554165-92554187 GAAAATGAATGGAGGAGGCCGGG + Intronic
1087128624 11:94650433-94650455 CAAAATGCACAAATGAGGCAAGG - Intergenic
1087167197 11:95016859-95016881 GAAAATGCACAGCAGTGGCCAGG + Intergenic
1087485755 11:98758131-98758153 AAAAATCCACACAATAGGCCAGG - Intergenic
1087491943 11:98838857-98838879 TAAAATGGGCAAAAGAGGCCAGG - Intergenic
1087527787 11:99339482-99339504 GAAAATGTCCTGAAGTGGCCAGG + Intronic
1087748422 11:101977335-101977357 TAAAAAGCAAAGAAAAGGCCGGG + Intronic
1088074478 11:105829891-105829913 GAAAATGTGCAGAAGAGAGCTGG + Intronic
1089128792 11:116195676-116195698 GGAAATGAACAAAAGAGGACTGG + Intergenic
1089176887 11:116555151-116555173 AAAACTGGACAGAATAGGCCGGG + Intergenic
1089227557 11:116938419-116938441 GAAAATGAAAAGAAGGGGACGGG + Intronic
1089227580 11:116938511-116938533 GAAAATGAAAAGAAGGGGACGGG + Intronic
1089264951 11:117252162-117252184 GAAAATGCAAATCATAGGCCAGG - Intronic
1089626506 11:119754542-119754564 GGAAATGCACAAAACAGGACAGG + Intergenic
1090335560 11:125960880-125960902 GTAACTGCACACAACAGGCCTGG - Exonic
1090448847 11:126788425-126788447 GAACATGGACAGAGGAGGCAAGG - Intronic
1091384000 12:80746-80768 GAAAAAGCAGAGAAGAGACCCGG + Intronic
1092525417 12:9306699-9306721 GAAAATGGAGAGGATAGGCCGGG + Intergenic
1092541855 12:9425118-9425140 GAAAATGGAGAGGATAGGCCGGG - Intergenic
1092708793 12:11312215-11312237 GAAAAGGAGCAGCAGAGGCCAGG + Intergenic
1093040242 12:14370229-14370251 AAAAATGCACATAGGAGGCCAGG - Intronic
1093149642 12:15605742-15605764 GAAGATGCAGAGAGGAGTCCGGG - Intergenic
1093933914 12:24981183-24981205 GACACTGCACAGAAGAGGCCAGG + Intergenic
1094439390 12:30457813-30457835 TAAAATGAACAGAAGAAGACAGG - Intergenic
1094511174 12:31097382-31097404 GAAAATGGAGAGGATAGGCCGGG + Intronic
1096467242 12:51853432-51853454 AAAAATGCACAGTCTAGGCCAGG + Intergenic
1096603770 12:52749829-52749851 GAAAAAGTAAAGAAAAGGCCTGG + Intergenic
1096672141 12:53206412-53206434 GAGAAAGCACAGCAGAGGCCTGG - Intronic
1096685020 12:53282549-53282571 GAACCTGCACAGAGTAGGCCTGG + Intronic
1096735643 12:53651661-53651683 GAAAAAGAACAAAATAGGCCGGG - Intronic
1097619896 12:61926775-61926797 GAAAATGGGCACAAGAGGGCAGG + Intronic
1097665631 12:62474411-62474433 GAAAAGAAAAAGAAGAGGCCAGG - Intronic
1098431647 12:70425997-70426019 GAAAATGACCTGAACAGGCCAGG + Intronic
1098920384 12:76297076-76297098 GAAACTGAACAGAAGACGCAAGG - Intergenic
1099095251 12:78367825-78367847 GAAAATGCTCAAATGAGGGCAGG - Intergenic
1099207971 12:79749672-79749694 AAAAGTGCTCAGCAGAGGCCAGG + Intergenic
1099265785 12:80446038-80446060 TTAAATGCAAACAAGAGGCCAGG + Intronic
1099274652 12:80559337-80559359 GAAAAGGCACACTACAGGCCGGG - Intronic
1099514316 12:83577869-83577891 TAAATATCACAGAAGAGGCCTGG - Intergenic
1100022272 12:90083908-90083930 GCAAGTGCATAGAAGAGGCATGG - Intergenic
1100285747 12:93164867-93164889 TGAGATGCACAGAAGAGGCCTGG + Intergenic
1100844826 12:98647116-98647138 AAAAATTGACAGTAGAGGCCGGG + Intronic
1101220007 12:102628886-102628908 CAAAATGTATAGAGGAGGCCAGG - Intergenic
1101772642 12:107765786-107765808 AAAAATGGACAGAAAATGCCTGG + Intergenic
1101950571 12:109171643-109171665 GAAAATGTAAAGAGAAGGCCAGG - Intronic
1101953096 12:109191507-109191529 GGAAAAGCACAGGAGTGGCCGGG - Intronic
1102506991 12:113389999-113390021 GAAAATGGACAAATGAGGCCAGG - Exonic
1103213725 12:119185767-119185789 GAAAATGCAGAAAATAGGCCGGG - Intronic
1103746125 12:123125547-123125569 GAAAATGCATGGTACAGGCCAGG + Intronic
1103753707 12:123185928-123185950 GAGATTACACAGGAGAGGCCGGG + Intronic
1103909884 12:124346402-124346424 GAACACGCACAGCTGAGGCCCGG + Intronic
1104028380 12:125046256-125046278 GAAAATGTTTAAAAGAGGCCGGG + Intergenic
1104346384 12:128003427-128003449 GAGAATACACAGAATTGGCCAGG + Intergenic
1104493173 12:129212348-129212370 GGAAATACACAGAGGAGGCAGGG - Intronic
1104745766 12:131209519-131209541 ACAAATGCGCAGAAGACGCCTGG + Intergenic
1104987205 12:132603849-132603871 GAAAAGCCACAGCAGAGGTCGGG + Intronic
1105249488 13:18685094-18685116 AAAAGAGCACAGAAGAGTCCAGG - Intergenic
1105404650 13:20123388-20123410 GAACAGGGACAGCAGAGGCCTGG - Intergenic
1105437196 13:20389447-20389469 TAAAATGCACCGATCAGGCCAGG - Intergenic
1106285283 13:28313272-28313294 TAAAATGTAAAGAAGAGGCCGGG - Intronic
1106536625 13:30650187-30650209 GAAAATGAACAGAAAAGGGAAGG + Intronic
1106669800 13:31892426-31892448 TTAATAGCACAGAAGAGGCCGGG + Intergenic
1107261953 13:38502966-38502988 GAAAGTGGACAGAGGATGCCAGG - Intergenic
1107524036 13:41212782-41212804 GAAAATACACAGAGGAGGCAGGG - Intergenic
1108238122 13:48430443-48430465 GAAAAATAACAGTAGAGGCCAGG + Intronic
1109019920 13:57076770-57076792 GTAAAGCCACAGAAGCGGCCAGG + Intergenic
1109461231 13:62661052-62661074 GAAAATTCACTCAAGAGGCCAGG - Intergenic
1109610774 13:64762234-64762256 GAAAATGCCTGCAAGAGGCCAGG - Intergenic
1110226630 13:73126267-73126289 TAAAATTCACATAATAGGCCAGG - Intergenic
1110305645 13:73984130-73984152 GAAATGGCAGAGAAGAGGCAAGG + Intronic
1110664801 13:78104239-78104261 GAAAATGCAAAGAATTGGCGTGG + Intergenic
1110721960 13:78772111-78772133 GAGAATGGAGAGAAGAGGACAGG + Intergenic
1111101989 13:83599934-83599956 GAAAATGCAGAGAAGGGCCCGGG + Intergenic
1111817363 13:93170311-93170333 GTCAAACCACAGAAGAGGCCAGG - Intergenic
1112158759 13:96847083-96847105 GAAAAAGGACAGCAGAGACCTGG + Intergenic
1112576290 13:100639642-100639664 AAAACGGCACAGAGGAGGCCTGG + Intronic
1112865751 13:103895489-103895511 GAAAATGGAAAGAAGAGTCTCGG + Intergenic
1113024790 13:105928846-105928868 GGAAATGAACAGAAGTGACCTGG - Intergenic
1113357320 13:109593786-109593808 GAAAATGCCAAGAAGAGGAAAGG + Intergenic
1114338961 14:21723333-21723355 GAAAATGCACAGAAAAAGAAAGG - Intergenic
1114598500 14:23934666-23934688 GGAAATGCCCAGAATAGCCCAGG + Intergenic
1114828958 14:26115194-26115216 GAGAAGGCACAGAAGAGCACTGG + Intergenic
1115559602 14:34571136-34571158 GAAAAGACATAGAAGAGGCCAGG + Intronic
1115590426 14:34859144-34859166 TAAGATCCACAGAAAAGGCCAGG + Intronic
1115747147 14:36449526-36449548 GCAAATGGAAAGAAGAGGCCTGG - Intergenic
1115962382 14:38850098-38850120 GGAAAGGCAAAGAAGAGGCAGGG + Intergenic
1116799868 14:49431425-49431447 TAAAATGCACAGAGAGGGCCAGG + Intergenic
1117406287 14:55407422-55407444 AAAAATGCAAAAATGAGGCCGGG - Intronic
1118029732 14:61808404-61808426 TAAAATGCAAAGAAAAGGCCAGG - Intergenic
1118117590 14:62798114-62798136 GAAAAAGCATAAACGAGGCCAGG - Intronic
1118161701 14:63297336-63297358 AAAAATGCATAGAATAGGCTGGG - Intergenic
1118267955 14:64313592-64313614 GAAAAAAGAAAGAAGAGGCCAGG + Intronic
1118679912 14:68230077-68230099 GAGAAGGCACAGAGGAGACCAGG + Intronic
1118870334 14:69736065-69736087 TAAAATGGCCAGAAAAGGCCAGG - Intronic
1121000156 14:90445968-90445990 AAAAATACCTAGAAGAGGCCGGG - Intergenic
1121805420 14:96816033-96816055 GAAAATGTACAGAAGGAACCTGG + Intronic
1122994533 14:105255829-105255851 TAAAATGCATGCAAGAGGCCAGG + Intronic
1202828947 14_GL000009v2_random:5106-5128 GAAAAGCCACGGAAGAGGCAGGG - Intergenic
1123784429 15:23655024-23655046 AAAAATGTACAGAATAGGCCAGG - Intergenic
1123972212 15:25517902-25517924 AAAAATGCACAGAGGGGGCCGGG - Intergenic
1124212201 15:27772545-27772567 GAAAATGGAGAGAACTGGCCGGG + Intronic
1124598230 15:31109399-31109421 AAAAATAGAAAGAAGAGGCCAGG + Intronic
1125142676 15:36428152-36428174 GAACTTCTACAGAAGAGGCCAGG - Intergenic
1125404811 15:39341348-39341370 GAGAATGCAGAGAGGAGCCCAGG + Intergenic
1126058550 15:44756185-44756207 GAAAAAGAAAAGAAAAGGCCGGG - Intronic
1126258071 15:46651631-46651653 GAAACTTCAAAGAATAGGCCAGG - Intergenic
1126609186 15:50511699-50511721 TAAAATACCCAGAATAGGCCAGG + Exonic
1126878524 15:53070133-53070155 GGAAATGCTCAGCAGAGGGCTGG + Intergenic
1126901727 15:53321477-53321499 GGAAATGCACAGATGGGCCCAGG - Intergenic
1127417818 15:58774185-58774207 AGAAATGCAAAGATGAGGCCGGG + Intronic
1127506811 15:59605843-59605865 GAAAATGTATAGAATAGGCCGGG - Intronic
1127829166 15:62735183-62735205 GAAATTTCACAGATGAAGCCTGG - Intronic
1128588768 15:68875833-68875855 GAAAATGAACATCAGAGGCATGG - Intronic
1128826980 15:70728266-70728288 TAAAAATCATAGAAGAGGCCAGG + Intronic
1129433277 15:75517036-75517058 AAAAATGCACAGGAACGGCCAGG - Intronic
1129446182 15:75620042-75620064 TAAAATATACATAAGAGGCCGGG - Intronic
1129446366 15:75621555-75621577 GGAACTGCTCAGAAAAGGCCGGG - Intronic
1129923126 15:79337678-79337700 GAACGTGCACAGAAGATTCCTGG + Intronic
1130348896 15:83073192-83073214 GAAAATACAGAAAACAGGCCAGG + Intergenic
1130404986 15:83591302-83591324 GAAAAAACATAGGAGAGGCCGGG - Intronic
1130526302 15:84709736-84709758 AAAAATGAACAGAAGAGGCCAGG - Intronic
1130676095 15:85953307-85953329 AGAAATGCAGAGAGGAGGCCAGG - Intergenic
1130954167 15:88615157-88615179 GAAAAAACACAGACGAGGCCGGG - Intergenic
1131474953 15:92730342-92730364 TAAAATGGGCAAAAGAGGCCAGG + Intronic
1132237492 15:100233031-100233053 TAAATGGTACAGAAGAGGCCAGG + Intronic
1132346884 15:101113947-101113969 GGAATTGCAGAGCAGAGGCCAGG - Intergenic
1132702406 16:1227567-1227589 TAAAATGCAAACAAGAGCCCGGG + Intronic
1132705917 16:1243301-1243323 AAAAATGCAAACAAGAGCCCGGG - Intergenic
1133458831 16:5968367-5968389 AAAAATGTACTGGAGAGGCCAGG - Intergenic
1133697147 16:8275557-8275579 GAAAGTGCACACAAGAGGGGAGG + Intergenic
1133919431 16:10139011-10139033 GAAAAAGAACAGAACAGGCTTGG + Intronic
1135810810 16:25585085-25585107 CAAAATTCAAGGAAGAGGCCGGG - Intergenic
1136298597 16:29318121-29318143 GAAAATGCACAGATGGGTGCAGG - Intergenic
1136401681 16:30022665-30022687 GAAAATACATAAAATAGGCCGGG + Intronic
1137680337 16:50337553-50337575 AAGAATGAACAGATGAGGCCAGG - Intronic
1137859467 16:51831554-51831576 GAAAAAGCTAAGAACAGGCCAGG - Intergenic
1138208945 16:55146790-55146812 GAATATGCAAAGAAAAGACCAGG + Intergenic
1138729173 16:59176039-59176061 GAAAAAGCAAAGCTGAGGCCAGG + Intergenic
1138761597 16:59550425-59550447 GGAAATGCACAGATGAGCCTAGG + Intergenic
1139268761 16:65663004-65663026 AAAAATGCAAAGAATCGGCCGGG + Intergenic
1139527658 16:67526787-67526809 GAAAGTACTCAGAAGATGCCTGG + Intronic
1139656081 16:68387944-68387966 GAATTTGCACAGAAAAGGCTTGG + Intronic
1139687336 16:68614487-68614509 GAAAGTGCAAATATGAGGCCAGG + Intergenic
1140043904 16:71426932-71426954 TAAAATCCACAAATGAGGCCGGG + Intergenic
1140586214 16:76295303-76295325 AAAAATGTTCAGAAGTGGCCAGG + Intronic
1140853635 16:78957850-78957872 GAATTTGCAGAGAAGAGGCTGGG + Intronic
1141049961 16:80752265-80752287 GAAAAAGAACATAAGAGGCATGG + Intronic
1141532937 16:84659296-84659318 GAAATTAAACAGAAGAGGCTGGG - Intronic
1142181660 16:88674150-88674172 GTAAAAGCAAAGAAGACGCCTGG - Intergenic
1142838442 17:2607468-2607490 GAAAAAGAAAAGAAAAGGCCAGG - Intronic
1142891138 17:2943852-2943874 TCAAAACCACAGAAGAGGCCAGG + Intronic
1143020431 17:3914716-3914738 GAGAAGGCACAGCAGAGGCCTGG + Intronic
1143111325 17:4554620-4554642 GAAAGTGTACCTAAGAGGCCGGG + Intronic
1143367047 17:6415204-6415226 GAAAATGCCAAGAAAGGGCCGGG + Intronic
1143392769 17:6569806-6569828 GAAACTGCACAGAAGGGGCTGGG + Intergenic
1143764318 17:9127543-9127565 GCAGGTGCAGAGAAGAGGCCAGG + Intronic
1144249950 17:13406197-13406219 GAGAAAGCAGGGAAGAGGCCAGG + Intergenic
1144280067 17:13717529-13717551 AAAAATGGGCAAAAGAGGCCAGG + Intergenic
1144409536 17:14987073-14987095 GAAGATGAACAGAAGACACCTGG + Intergenic
1144711357 17:17403665-17403687 GAAAATGCACGGAGGAGCCTGGG + Intergenic
1146039975 17:29442759-29442781 AAAAATGCTCACAACAGGCCTGG + Intronic
1146287365 17:31582873-31582895 GAAAATGAAGAGATGAGGCCAGG + Intergenic
1146308952 17:31752289-31752311 TAAAATGCACAAAATAGGCCTGG - Intergenic
1146487887 17:33258877-33258899 GAACATGCACAGTGGAGGCCGGG + Intronic
1146491683 17:33287892-33287914 ATAAATGCCCAGAAGTGGCCTGG + Intronic
1146706390 17:35003608-35003630 GAAAGTGCTCAAAAGAGGCCGGG - Intronic
1146725955 17:35155863-35155885 GAAAATACATATAACAGGCCAGG - Intronic
1146733253 17:35213974-35213996 GAAGATGCAAAGAAAAGGTCAGG + Intergenic
1147285034 17:39395527-39395549 GAAAATACATAGCAAAGGCCTGG - Intronic
1148001280 17:44388958-44388980 TGAAATGCAGAGAGGAGGCCGGG - Intronic
1148350059 17:46934868-46934890 GAAAAAGCAAAGCAAAGGCCTGG - Intronic
1148644841 17:49213780-49213802 GAAACTGTACAGAAGAAGGCAGG + Intronic
1148711685 17:49686376-49686398 GAAAAAGAAAAAAAGAGGCCCGG + Intergenic
1149151509 17:53570230-53570252 AAAAATAAACAGAGGAGGCCGGG + Intergenic
1149302376 17:55317260-55317282 TAAAATACACAAAAAAGGCCGGG - Intronic
1149520159 17:57312622-57312644 GAAAATTCTCTGAAGATGCCTGG + Intronic
1149720631 17:58840576-58840598 GAAAATGTACAGAACCAGCCTGG + Intronic
1150278468 17:63914664-63914686 CAAAAGGCTCAGAATAGGCCGGG + Intronic
1150306906 17:64093380-64093402 GAAACTGAACAGATGGGGCCAGG - Intronic
1151434478 17:74086401-74086423 GAAAATGCCAAGTAGGGGCCAGG + Intergenic
1151487014 17:74407412-74407434 GAAAACACACAGAAGAGGTGAGG + Intergenic
1151876116 17:76869056-76869078 GATAATGGTCAGAAGATGCCTGG + Intronic
1152012474 17:77726981-77727003 GAACATGCAAAGAGGGGGCCAGG - Intergenic
1152053963 17:78007138-78007160 GAAAATTCTCAACAGAGGCCAGG - Intronic
1152090860 17:78246848-78246870 AAAAATGGACAAAAGAGGCCAGG - Intergenic
1152443257 17:80322708-80322730 AAAAATGAGCAAAAGAGGCCAGG - Intronic
1152584998 17:81185046-81185068 GAAAATAAAAAGAAGGGGCCGGG + Intergenic
1152840292 17:82563100-82563122 TAAAAAGCACAGACAAGGCCAGG - Intronic
1153204701 18:2685392-2685414 AAAAAGGGACAGAATAGGCCAGG - Intronic
1153375482 18:4372629-4372651 GAAAAGGTACAGATCAGGCCAGG + Intronic
1154154671 18:11934663-11934685 AAAAATAGACAGAAGGGGCCGGG + Intergenic
1154390298 18:13931178-13931200 GACAAGGCACAGAAAAGCCCAGG - Intergenic
1154439345 18:14373807-14373829 AAAAGAGCACAGAAGAGTCCAGG + Intergenic
1155170303 18:23262327-23262349 GACATTGCTCAGATGAGGCCTGG + Intronic
1155264329 18:24076273-24076295 GAAAAACCACAGAGCAGGCCGGG - Intronic
1156418252 18:36921697-36921719 AAAAATGTAAAGAAAAGGCCGGG - Intronic
1157496731 18:48161880-48161902 GAGAATGCGGAGGAGAGGCCCGG - Intronic
1157512413 18:48286754-48286776 AAAACTGACCAGAAGAGGCCAGG + Intronic
1157739064 18:50075902-50075924 GTAAATGCACATCAGAGGCCAGG + Intronic
1157744275 18:50121025-50121047 GAAAATGCCCAGAGGAGAGCAGG - Intronic
1157891657 18:51423822-51423844 GAAAATGTCCAGAATAGGCCAGG - Intergenic
1158413098 18:57224995-57225017 GAAAATACACATTTGAGGCCGGG - Intergenic
1158573341 18:58615107-58615129 TAAAATGTCCAGAATAGGCCGGG - Intronic
1158671145 18:59475017-59475039 GAAAATGCACAAAATGGGCAGGG - Intronic
1158766867 18:60461291-60461313 GAAAATGCAAAGAAGTGGAAAGG + Intergenic
1159863239 18:73673972-73673994 GAAAATGTACAGAATGAGCCTGG - Intergenic
1160224482 18:77001553-77001575 GAAAATGCCCGTAAGAGGCCAGG + Intronic
1160318798 18:77871217-77871239 GAAAATGGAAAAAAGAAGCCAGG - Intergenic
1160771361 19:832782-832804 AAAATTACACAGGAGAGGCCGGG + Intergenic
1160798916 19:958453-958475 GAAAAAGAAAAGAAGAGGACAGG + Intronic
1161214352 19:3086059-3086081 GAAAAAGAAAAGAAAAGGCCAGG - Intergenic
1161467657 19:4440822-4440844 GAAAAGGCACAGCAGAGGCCAGG + Intronic
1161503862 19:4633404-4633426 GAGAATGCACTGAAGAGGCAGGG + Intergenic
1161517805 19:4706199-4706221 GAAACAGCACACAAGAGGCTGGG + Intronic
1161971637 19:7584630-7584652 GAAAATGAAAATAAAAGGCCGGG - Intergenic
1162114941 19:8423353-8423375 GCAAATTCAGAGAAGAGGCCAGG - Intronic
1162347516 19:10128540-10128562 TAAAGTACACAGGAGAGGCCGGG - Intergenic
1162424324 19:10584934-10584956 AAAAAAACAAAGAAGAGGCCAGG + Intronic
1162454947 19:10777888-10777910 GAAAATGCTCATAATAGGCCGGG - Intronic
1162477164 19:10907579-10907601 AGAAAAGCACAGTAGAGGCCAGG - Intronic
1162717297 19:12642119-12642141 GAAAAAGAAAAAAAGAGGCCCGG + Intergenic
1163014443 19:14445597-14445619 GAAAATGAATAGAGTAGGCCAGG + Intronic
1163105628 19:15121518-15121540 GAAGAAGAAGAGAAGAGGCCAGG + Intronic
1164044453 19:21523935-21523957 GTAAATCCCAAGAAGAGGCCTGG - Intronic
1164662887 19:29993818-29993840 GTAAATGCACAGAATATCCCTGG - Intronic
1164806398 19:31120456-31120478 CAATGTGCAGAGAAGAGGCCAGG + Intergenic
1165159462 19:33807426-33807448 GAAAATGCAAAAATTAGGCCTGG + Intronic
1165215796 19:34271541-34271563 GAAAGTGCACAGAAGGGGCCGGG - Intronic
1166192435 19:41183909-41183931 GAAAATCCACAGTAGTGGTCAGG + Intergenic
1166408485 19:42540526-42540548 AAAAAGGCACTGAAGAGGGCCGG - Intronic
1166573959 19:43819501-43819523 GAAAAAGGACAGAAAAGACCCGG - Intronic
1166676615 19:44745266-44745288 GAAACTTCCCAGAGGAGGCCAGG - Intergenic
1166745321 19:45139367-45139389 GCCAACGCACAGAAAAGGCCAGG - Intronic
1167398384 19:49247003-49247025 GAAAATGCAAAGGACCGGCCGGG - Intergenic
1167419181 19:49393218-49393240 TAAAGTGCTCAGAAAAGGCCTGG + Intronic
1167530082 19:50009934-50009956 GAAATTACATGGAAGAGGCCAGG - Intronic
1167830401 19:52015902-52015924 GAAAATGCACACAAGAGAAATGG - Exonic
1168022442 19:53619377-53619399 AAAAATGCAGAAAACAGGCCGGG + Intergenic
1168122984 19:54264815-54264837 AAAAAGGCACAAAAGTGGCCGGG - Intronic
1168382128 19:55932795-55932817 GAAAATACCCAGTTGAGGCCGGG - Intergenic
1168662779 19:58181201-58181223 AAAAAAGTACAAAAGAGGCCAGG + Intergenic
1202643748 1_KI270706v1_random:122694-122716 GAAAAGCCACGGAAGAGGCAGGG + Intergenic
925591948 2:5518480-5518502 GAAAATGTAAAGAATCGGCCAGG + Intergenic
925865544 2:8223224-8223246 GGACATGCACAGCAGGGGCCTGG + Intergenic
926347729 2:11963854-11963876 GAAAATGCACTGAAGAAGAAAGG + Intergenic
926383212 2:12311959-12311981 GGAAAGGTACAAAAGAGGCCAGG - Intergenic
926404545 2:12537875-12537897 GAACATGCACAGAAATGCCCTGG + Intergenic
926785626 2:16515857-16515879 TAAAATGCTCAGGAGAGGCTGGG - Intergenic
927542927 2:23928286-23928308 AAAAATTCACAGTACAGGCCGGG + Intronic
927701719 2:25273392-25273414 GAAAGTGCAGAACAGAGGCCAGG - Intronic
927865272 2:26583895-26583917 AAATCTGCAAAGAAGAGGCCAGG + Exonic
928545764 2:32327893-32327915 GAAAATAGATATAAGAGGCCGGG - Intergenic
928552664 2:32388500-32388522 GAAAATGTGCAGTAAAGGCCAGG - Intronic
928685705 2:33746997-33747019 AAAAATTAACACAAGAGGCCGGG + Intergenic
928791314 2:34957927-34957949 GAAAATACAGAAAACAGGCCGGG - Intergenic
929050858 2:37835444-37835466 AAAAATGAAGAGAAGCGGCCGGG - Intergenic
929754238 2:44750716-44750738 AGAAATGCAAAGATGAGGCCGGG + Intronic
929837345 2:45417028-45417050 GAAAACTCACAGCATAGGCCAGG - Intronic
930080743 2:47446339-47446361 GAAAAGAAACAGAAGTGGCCCGG - Intronic
930852855 2:55980008-55980030 GAAAATGCACATAGAATGCCTGG + Intergenic
931412152 2:62042788-62042810 CAAAATGCACAAAAGAGGCCGGG - Intronic
931635210 2:64334349-64334371 AAGAATGGACAGAAGAGGCTTGG - Intergenic
932283006 2:70510843-70510865 CAAAATGCACAAGAAAGGCCAGG + Intronic
932434427 2:71694874-71694896 AAGAATGCCCAGAGGAGGCCAGG + Intergenic
932686928 2:73878847-73878869 TAAAAAGCAGATAAGAGGCCGGG + Intergenic
933053525 2:77631979-77632001 GAAAACAACCAGAAGAGGCCAGG - Intergenic
933842485 2:86298590-86298612 GAAACAGCCCAGCAGAGGCCAGG - Intronic
933854580 2:86400821-86400843 AAAAATGCACTTAAGGGGCCAGG + Intergenic
934506184 2:94896605-94896627 GAAAAGCCACAGAAGAGGCAGGG + Intergenic
934555608 2:95285614-95285636 GCAGGTGGACAGAAGAGGCCAGG - Intronic
934924746 2:98374437-98374459 TAAAATGAACAGACCAGGCCAGG - Intronic
935511770 2:103984551-103984573 GAAAGTGGCCAGTAGAGGCCGGG - Intergenic
935700634 2:105808642-105808664 GACAATGCACTGAAGACGCTGGG - Intronic
937236972 2:120436997-120437019 GAAAATGGCCAGAAGAGGAGAGG + Intergenic
937254437 2:120545193-120545215 GAAAAGTCACAGACGTGGCCGGG + Intergenic
937523593 2:122740424-122740446 GAAAGTGAACAGCAGAGGCTGGG + Intergenic
938076937 2:128344985-128345007 GAAAATGCAAATTAAAGGCCTGG + Intergenic
938375697 2:130804715-130804737 AAAAATGGACAAAGGAGGCCAGG + Intergenic
938516874 2:132018616-132018638 AAAAATACACAGAAGAGTACGGG - Intergenic
938641575 2:133286289-133286311 AAGAAGTCACAGAAGAGGCCGGG - Intronic
938797041 2:134726416-134726438 GAGAATGCACAGCAAAGGCTGGG - Intergenic
938841902 2:135172469-135172491 GAAAATACACTGCAGAGGCTGGG + Intronic
938886592 2:135655787-135655809 GAAAAAGAACAGAGTAGGCCAGG - Intronic
939103610 2:137924564-137924586 AAAAGAGCACAGAAGAGTCCAGG - Intergenic
939152727 2:138492676-138492698 GAAAATAAAAAGAAAAGGCCAGG - Intergenic
940049017 2:149440998-149441020 AAAAGTGGACAGAATAGGCCAGG - Intronic
940630982 2:156238226-156238248 TCAAATGCTCAGAAGATGCCAGG - Intergenic
941173301 2:162165692-162165714 CAAAATCCACAGATGAGACCAGG + Intergenic
941340899 2:164301919-164301941 GAAAAAGTACAAAAGTGGCCAGG + Intergenic
941385650 2:164848053-164848075 GAAAAGGCACAGGAGGGGCAAGG - Intergenic
941413229 2:165186586-165186608 GATAATTCACAGAAGGGACCTGG - Exonic
941619336 2:167758647-167758669 AAAAATGCACGAAACAGGCCAGG - Intergenic
941946981 2:171110172-171110194 GAAAATGGACTAAAAAGGCCAGG + Intronic
942049776 2:172128452-172128474 AAAAATGCAAAGAATAGGGCCGG - Intergenic
943017661 2:182533017-182533039 TAAAAAGCAAAGAAGAGGCCAGG + Intergenic
943122978 2:183760572-183760594 GAAAATGGACACTAGAGACCTGG - Intergenic
944583604 2:201154382-201154404 GAAAATGGAGAGAATAAGCCAGG - Intronic
944791954 2:203140003-203140025 GAAAATACACAAAAGCGGCTGGG + Intronic
944833584 2:203556835-203556857 GAAAGTGTACAGGAGAGGCTGGG + Intergenic
945492345 2:210471338-210471360 GAAAAATCAAAGAAGAGGCTGGG - Intronic
945807505 2:214508266-214508288 AAAAGTGCACAGAAGAGCCGGGG - Intronic
946288730 2:218726760-218726782 GAAATTTCACAAAAGAGGCCAGG - Intronic
946554803 2:220844023-220844045 GTAAAGGTACAGAAGAGGCTGGG - Intergenic
946726377 2:222665463-222665485 AAATATGTACAGAAGAGGCCAGG - Intergenic
947331032 2:229029545-229029567 AAAAATTCAAAGTAGAGGCCGGG + Intronic
947386737 2:229598267-229598289 GTAAAAGTACAGAAGAGGCAGGG - Intronic
947457447 2:230268226-230268248 AAAAATAGACAGAAGAGGCCGGG + Intronic
947629044 2:231639920-231639942 TAAAATTCACAGAAGAGGCCGGG - Intergenic
947958862 2:234217897-234217919 GAAAAGGCAGAGAAACGGCCAGG + Intergenic
948150749 2:235742869-235742891 AAAAATCTACAGAAGAGGCTAGG + Intronic
948494849 2:238341016-238341038 AAAAATACACATAAGAAGCCGGG - Intronic
948527958 2:238584745-238584767 TAAAATTCACAAAAGAGGCCAGG + Intergenic
1169202721 20:3720993-3721015 GAAAATGTAAAAAAGAGCCCAGG + Intergenic
1169248540 20:4042883-4042905 AGAAAAGCACAGAATAGGCCAGG - Intergenic
1170276979 20:14602213-14602235 GCACATGAACCGAAGAGGCCAGG + Intronic
1170685988 20:18569867-18569889 GAAAATGCAGATAGTAGGCCGGG - Intronic
1170723069 20:18901234-18901256 TGAAGTGCACAGAAGAGGGCTGG + Intergenic
1170985294 20:21252523-21252545 TAAAATGTACAGAAGTGGCCAGG + Intergenic
1171032213 20:21687204-21687226 TAAAATACACAGATGAGGCCAGG - Intergenic
1171559457 20:26110085-26110107 GAAAAAGCAAGAAAGAGGCCAGG + Intergenic
1171893712 20:30741645-30741667 GAAAAGCCACGGAAGAGGCAGGG + Intergenic
1172079164 20:32325483-32325505 GAAAATGTAAAAAACAGGCCAGG - Intronic
1172287345 20:33750094-33750116 GAAAATGCACAGTAGCTCCCTGG + Intronic
1172332765 20:34087176-34087198 GAAAATGCACAGCACTGGCCAGG + Intronic
1172475467 20:35234200-35234222 GTGAATGAACAGAAGAGGCTAGG - Intronic
1172662671 20:36578115-36578137 TAAAATGCTCAGTACAGGCCAGG + Intronic
1173069130 20:39744528-39744550 GGAAAAGCACAGTAGAGGCTGGG - Intergenic
1173214380 20:41066847-41066869 TAAAAGGCACAGAAGTGGCCAGG - Intronic
1173837212 20:46133851-46133873 AAAAATCCACAAAAGTGGCCGGG + Intergenic
1174226127 20:49001949-49001971 TAAAATACACATAACAGGCCGGG + Intronic
1174516724 20:51098177-51098199 GAAAATGCACATACCAGACCAGG - Intergenic
1174800166 20:53556909-53556931 AAAAAGACACTGAAGAGGCCAGG - Intergenic
1176456338 21:6915601-6915623 AAAAGAGCACAGAAGAGTCCAGG - Intergenic
1176608130 21:8849934-8849956 GAAAAGCCACGGAAGAGGCAGGG - Intergenic
1176675803 21:9776065-9776087 GAAAATGCACACTCGGGGCCGGG - Intergenic
1176834512 21:13780661-13780683 AAAAGAGCACAGAAGAGTCCAGG - Intergenic
1177633605 21:23757915-23757937 GAAAATAAAAACAAGAGGCCGGG + Intergenic
1178359521 21:31936555-31936577 AAAAATGCACAGAATAAACCTGG - Intronic
1178554423 21:33575613-33575635 GAAAGAGCACAAAAGAGGTCTGG + Exonic
1178609747 21:34070733-34070755 TAACAAGCACAGAAGCGGCCGGG - Intergenic
1178663672 21:34527917-34527939 GAAGATGCAGGGAAGATGCCTGG + Intronic
1179533245 21:42034335-42034357 AAAAAAGCAGAGAAGGGGCCGGG - Intergenic
1180094280 21:45548446-45548468 TAAAACACACAAAAGAGGCCGGG + Intergenic
1180358221 22:11859739-11859761 GAAAAGCCACGGAAGAGGCAGGG - Intergenic
1180380044 22:12132591-12132613 GAAAAGCCACGGAAGAGGCAGGG + Intergenic
1180673192 22:17569302-17569324 TAAAAAGCAAAGAAGAGGGCTGG - Intronic
1180946487 22:19696467-19696489 CCAAAGGCACAGCAGAGGCCTGG - Intergenic
1181092770 22:20485570-20485592 GAAAAGGCAGAGAAGAGGCCAGG + Intronic
1181381809 22:22510831-22510853 TAAAATGTACGTAAGAGGCCTGG + Intergenic
1181412109 22:22731277-22731299 GACAATGCACGGATGTGGCCCGG + Intergenic
1181660324 22:24342373-24342395 GAAAAAGAATAGAGGAGGCCAGG + Intronic
1181717608 22:24744275-24744297 GAAAAAACACAAAAAAGGCCAGG + Intronic
1181741515 22:24925060-24925082 GAAAAGGCATACAGGAGGCCGGG + Exonic
1181845149 22:25700877-25700899 CAAAATACCCAAAAGAGGCCGGG - Intronic
1182110742 22:27721432-27721454 GGAAATGCACAGGAGATGCCAGG + Intergenic
1182593913 22:31403370-31403392 GAAAATGCAGAGAAAGGGCCGGG + Intronic
1182673167 22:32015116-32015138 GAAAAAGCAGAGATGAGGCCGGG + Intergenic
1182874074 22:33674995-33675017 AAAAATGAACACAAGAGGCCAGG + Intronic
1183046488 22:35224665-35224687 TAAAATGCATAGCAGAGGCCAGG - Intergenic
1183163258 22:36128812-36128834 GAAATCACACAGAAGAGGCCAGG + Intergenic
1183428746 22:37753117-37753139 GAAAATGCTTCTAAGAGGCCTGG + Intronic
1183443300 22:37836149-37836171 AAAAATGGACAAAAGAGGCCAGG + Intronic
1183472734 22:38018158-38018180 GAAAGTTCACAGATGAGCCCTGG - Intronic
1185290662 22:50025369-50025391 ATAAATACACAGAAGAGGCCGGG + Intronic
949128764 3:476506-476528 GAAAGTGACAAGAAGAGGCCAGG - Intergenic
949466379 3:4348567-4348589 TAAAAACCTCAGAAGAGGCCAGG + Intronic
949475740 3:4443466-4443488 TAAAATAAAAAGAAGAGGCCAGG + Intronic
949689310 3:6616928-6616950 GGAAATGCACTGTAGAGGCTGGG - Intergenic
949753267 3:7379043-7379065 TAAAATGCCCAGAAGACGCCTGG - Intronic
949753309 3:7379386-7379408 TAAAATTCACAGAAGAGTCTGGG - Intronic
950052746 3:10004653-10004675 GACAGGGCAGAGAAGAGGCCAGG - Intronic
950514233 3:13453752-13453774 GAAATTCCAGAGAATAGGCCAGG + Intergenic
950900269 3:16491264-16491286 GCAAAAGCCCAGAGGAGGCCTGG + Intronic
951215110 3:20016561-20016583 GAAAATACAGAAAACAGGCCGGG - Intergenic
951380337 3:21976530-21976552 GGAAATACACAGAAGAGTACAGG + Intronic
951874958 3:27413982-27414004 AAAAATACACAGTTGAGGCCAGG + Intronic
951927326 3:27922484-27922506 GAAAATGTAAAGCAGAGGCGGGG - Intergenic
952171598 3:30812990-30813012 GAAAATGCAGTGAGGAAGCCTGG + Intronic
952322588 3:32292134-32292156 GAAAATGTTCAGAAGAATCCAGG + Intronic
952324258 3:32306911-32306933 AAAAATGGAGAGAAGATGCCAGG + Intronic
952519664 3:34144043-34144065 GGAAAGGCATAGAAAAGGCCAGG - Intergenic
952527330 3:34224280-34224302 GAGAATGCACAAAAGAGGCTGGG - Intergenic
952811533 3:37408652-37408674 AGAAAAGCACAGAATAGGCCAGG - Intronic
952960233 3:38584630-38584652 CAAAATGCAGTGAAGAGGCCAGG + Intronic
953028632 3:39161253-39161275 TCAAAAGCACAGAATAGGCCGGG + Intergenic
953377072 3:42437653-42437675 TAAAATGTCCAGAATAGGCCAGG + Intergenic
955165077 3:56503007-56503029 GAAAAGGCAGAGAAGACCCCAGG + Intergenic
955373568 3:58374467-58374489 GAAAATGGAAAGGGGAGGCCAGG - Intronic
955508074 3:59651898-59651920 GAAAATGCACATAAGTTACCTGG - Intergenic
955965404 3:64383822-64383844 AAAAACACACAAAAGAGGCCAGG - Intronic
956177202 3:66484171-66484193 GGAAATACACAGATGAAGCCTGG + Intronic
956450434 3:69369335-69369357 GAAAAAACAAAGAAAAGGCCAGG + Intronic
956606505 3:71078125-71078147 GAAAATATACAGAGGAGGCCGGG - Intronic
956657823 3:71568940-71568962 GAAAATTCAGAGAACAGGCTGGG - Intronic
956840590 3:73136182-73136204 AAAAATATACAGAATAGGCCAGG - Intergenic
956929157 3:74023040-74023062 GAAATGGCACAAAAGAGGGCTGG - Intergenic
957304269 3:78436782-78436804 GAAAATGCACAAGAAAAGCCTGG + Intergenic
958453809 3:94305634-94305656 GCAAATGCACAGAGGATTCCTGG - Intergenic
958864188 3:99481966-99481988 GATCATGCATAGAAGGGGCCAGG - Intergenic
959541711 3:107547638-107547660 GAAAGTACACAGAAGAGTGCCGG - Intronic
960111810 3:113852027-113852049 GATAAAGTACAGAATAGGCCGGG - Intronic
961179931 3:124868482-124868504 GAAAATGAAGGCAAGAGGCCAGG + Intronic
961338765 3:126203280-126203302 GAAAATGCAGAGAAGGGGGCTGG + Intergenic
961452991 3:127010846-127010868 AAAAATGCCCAGAGGAGCCCAGG - Intronic
961549151 3:127657593-127657615 GAAAGTGCAAAGAAGAGTCAGGG - Intronic
961610630 3:128134489-128134511 GAAAATACACAGAGGTGGCCAGG + Intronic
962432033 3:135328840-135328862 GCAGATGCACAGAAGGAGCCTGG + Intergenic
962867982 3:139463479-139463501 TAAAAACAACAGAAGAGGCCGGG - Intronic
963157556 3:142115611-142115633 GAAAATGCATGGAATGGGCCGGG - Intronic
963217260 3:142762329-142762351 AAAAAAATACAGAAGAGGCCAGG - Intronic
963285753 3:143432919-143432941 TAAAATGCAGGCAAGAGGCCAGG - Intronic
963892781 3:150654362-150654384 GACAATGCACAGAAAAGTCCAGG - Intergenic
964556476 3:157945148-157945170 GAATTCACACAGAAGAGGCCGGG + Intergenic
964586805 3:158315874-158315896 GAAAATGCTGAAAATAGGCCAGG + Intronic
964684008 3:159375256-159375278 GAAGATGCTCAGATGAGCCCAGG + Intronic
965472302 3:169109709-169109731 AAAAATACTTAGAAGAGGCCGGG - Intronic
965730553 3:171767740-171767762 GAAAAGGCTTAGAACAGGCCGGG + Intronic
965921314 3:173918339-173918361 TAAAATGCATAGAATGGGCCGGG + Intronic
966669695 3:182513313-182513335 AAAAATCCATAGAAGAGGCTGGG - Intergenic
966831504 3:184013745-184013767 GAGAATGCTCAGAACAGACCGGG + Intronic
967462793 3:189765726-189765748 AAAAATGCAGAGGACAGGCCGGG - Intronic
967782987 3:193459780-193459802 GGATATGGACACAAGAGGCCAGG - Intronic
967784342 3:193474022-193474044 AGAAATACACAGTAGAGGCCAGG + Intronic
967844525 3:194033227-194033249 GAAAATGCTCACCAGAGGCCTGG - Intergenic
968036134 3:195549628-195549650 TAAAATGAAAAGAGGAGGCCAGG - Intergenic
968321321 3:197771479-197771501 GAAAATGCAAAAATTAGGCCGGG + Intronic
968333265 3:197890097-197890119 AAAAATGCACAGATAATGCCAGG + Intronic
968438043 4:605323-605345 GAAAGTGAACACAATAGGCCGGG - Intergenic
968544117 4:1187904-1187926 TAAAATACACATAACAGGCCAGG + Intronic
968772832 4:2519170-2519192 GAAAAGGTACAGAAAAGGCAGGG + Intronic
969034322 4:4240780-4240802 AAAAATACAAGGAAGAGGCCGGG + Intronic
969474055 4:7411247-7411269 CAAGATGGAGAGAAGAGGCCAGG - Intronic
969935011 4:10671654-10671676 GAAAATGCACACATGAGGAAGGG - Intronic
969941965 4:10741504-10741526 GTAAATGCTCAGAAGATGTCTGG + Intergenic
970548164 4:17150940-17150962 AAAAATACAGATAAGAGGCCAGG + Intergenic
970582365 4:17485257-17485279 CAAAATACCCAGAACAGGCCAGG + Intronic
971285070 4:25281107-25281129 GAACATGCACAGACGAGGGAAGG + Intergenic
971404903 4:26313370-26313392 AAAAATACAAAGAAAAGGCCAGG + Intronic
971860617 4:32099281-32099303 TAAAATGTACAGAAGAGTCAAGG - Intergenic
971990860 4:33891595-33891617 TAAAATAAACAGAAAAGGCCCGG - Intergenic
972168716 4:36318907-36318929 GAAAATGCACAGAAGAGGCCAGG - Intronic
972253661 4:37331767-37331789 GAAAAGGCACTGAAGAGGGTAGG + Intronic
972358665 4:38305880-38305902 AAAATTGTGCAGAAGAGGCCAGG - Intergenic
972443279 4:39117777-39117799 AAAAGTAAACAGAAGAGGCCAGG + Intronic
972463164 4:39325676-39325698 GAAGATTCACAGATGAGGCTGGG - Intronic
973085187 4:46050052-46050074 GAAAATCCAGAGAAGATGCATGG + Intronic
974674837 4:65076429-65076451 GAAAATGCCATGAAAAGGCCTGG - Intergenic
974713267 4:65631192-65631214 GAAAATGCACAGTGAAGGCAGGG - Intronic
975298014 4:72756413-72756435 TAAAAAACCCAGAAGAGGCCGGG + Intergenic
975821010 4:78270462-78270484 CAAAATACACAGAAGAGGGTAGG - Intronic
976254541 4:83086298-83086320 AAAAATGGACTGAGGAGGCCGGG + Intergenic
976799294 4:88970910-88970932 GAAAAAGCACAGAAGTTGGCCGG + Intronic
977310123 4:95375780-95375802 TAAAATATACAGAATAGGCCGGG + Intronic
977405568 4:96593514-96593536 AGAAATTAACAGAAGAGGCCTGG - Intergenic
977744239 4:100526130-100526152 GAAAGTACAGAGTAGAGGCCAGG + Intronic
978100708 4:104837482-104837504 GAAAATGCTCAGAAGAAGATGGG + Intergenic
980119753 4:128715504-128715526 TAAAATGGAGAGAAAAGGCCGGG - Intergenic
980311862 4:131141652-131141674 AAAAATGCAGATAACAGGCCGGG + Intergenic
981642124 4:146956811-146956833 GAAACAACACAGAAGAGGCATGG - Intergenic
981710861 4:147707833-147707855 AGAAATGCACAGAAATGGCCGGG - Intergenic
982304370 4:153914677-153914699 GAAAATTCACAGAGGAACCCTGG - Intergenic
982813873 4:159861375-159861397 TAAAGCACACAGAAGAGGCCTGG - Intergenic
982964624 4:161889345-161889367 GTAAATGCATAAAATAGGCCAGG + Intronic
982978512 4:162100263-162100285 GAAAACACATAGAGGAGGCCGGG + Intronic
983561915 4:169110077-169110099 GAAAATGAACGTTAGAGGCCGGG + Intronic
984927014 4:184815823-184815845 TAAAAAGCAGAGATGAGGCCAGG + Intronic
984967714 4:185155102-185155124 TAAAAATCCCAGAAGAGGCCAGG + Intergenic
984972411 4:185203330-185203352 GAAAATACACAGAAAAGCACCGG + Intronic
985117296 4:186604921-186604943 GAAAAGGAAGAGACGAGGCCAGG + Intronic
985300122 4:188479403-188479425 TAAAATCCCTAGAAGAGGCCGGG - Intergenic
1202771118 4_GL000008v2_random:208626-208648 GAAAAGCCACGGAAGAGGCAGGG + Intergenic
985501659 5:251535-251557 GAAAATGCAGAGAAAATGCAGGG - Intronic
986045754 5:4036078-4036100 GAAAATGCACAGAACGGGTGAGG + Intergenic
986282828 5:6337533-6337555 TAAAATGCACATAATAGGCTGGG + Intergenic
989386386 5:40858704-40858726 GAAAATGCAGAAATAAGGCCAGG + Intronic
989603092 5:43218304-43218326 AAAAATAGACAGAGGAGGCCGGG - Intronic
990431398 5:55738304-55738326 GAAAACGCAGTGAAGAAGCCAGG - Intronic
991654071 5:68885471-68885493 TAAAAAGCACAGCAGAGCCCAGG + Intergenic
992539978 5:77755281-77755303 TAAAATGTGCACAAGAGGCCAGG + Intronic
992551188 5:77861832-77861854 GAAAATGAGCAGAAAAGGTCTGG - Intronic
992742863 5:79791423-79791445 GAAAAGGCATAGAAGAGGCTGGG + Intronic
992809641 5:80373781-80373803 GAAAATGCAATGCAAAGGCCAGG - Intergenic
994015924 5:94965420-94965442 GAAAAGGCACAGTAAAGGGCTGG - Intronic
994363157 5:98878935-98878957 GAAACTGAATAAAAGAGGCCAGG + Intronic
995013692 5:107286486-107286508 GAAAATGTAATGTAGAGGCCGGG - Intergenic
995087835 5:108135639-108135661 GAAAATCCAGAGAAAAGGCAGGG + Intronic
995122248 5:108548682-108548704 TAAAATGCATAGATGAGGCCAGG + Intergenic
995247065 5:109946427-109946449 TAAAGTGCCTAGAAGAGGCCTGG - Intergenic
995940214 5:117572585-117572607 AAAAACACACAGAAGAGGCCTGG - Intergenic
995997520 5:118319719-118319741 AAAGATCCACAGAAGTGGCCAGG + Intergenic
996273785 5:121640105-121640127 AAATATGCATAGAATAGGCCGGG - Intergenic
996339007 5:122415572-122415594 GGAAATGGAGAGAAGAGGGCAGG + Intronic
997486598 5:134236140-134236162 AAACATGCACAGAAGAGGGATGG + Intergenic
998231249 5:140362852-140362874 GAAAATGCATGTAAGAGACCAGG + Intronic
998409789 5:141900921-141900943 TAAGATGCCCAGCAGAGGCCGGG - Intergenic
998419811 5:141973532-141973554 GAAAATGCACAGAGGCTGGCCGG - Intronic
998452810 5:142247691-142247713 TAAAAAGCAAGGAAGAGGCCTGG - Intergenic
998650683 5:144118295-144118317 GAAAATGCTTAGAAGTGACCTGG - Intergenic
999237551 5:150108113-150108135 GAAACAGCACAGTAAAGGCCTGG + Intronic
999770233 5:154770103-154770125 GAAAATGGACAGAGGAGGTAGGG + Intronic
999977489 5:156926197-156926219 AAAAATCCACAGTAGTGGCCAGG - Intronic
1000038793 5:157469316-157469338 GAAAATGCACAGTACAGAGCTGG + Intronic
1000039022 5:157471366-157471388 GAAAATGCACAGTACAGAGCTGG - Intronic
1000075144 5:157777707-157777729 GAAAAAGAAAAAAAGAGGCCAGG + Intergenic
1000131680 5:158306275-158306297 GAGAATGCAGAGAAAACGCCAGG - Intergenic
1001369212 5:171179805-171179827 GTAAATACTCAGAAAAGGCCTGG + Intronic
1001624639 5:173120995-173121017 TAAAATCCACATAAGAAGCCAGG - Intronic
1001973198 5:175973779-175973801 GAAAATGAAAAGAATAGGCCGGG + Intronic
1002041356 5:176516796-176516818 AAAAAGATACAGAAGAGGCCAGG - Intergenic
1002244239 5:177870004-177870026 GAAAATGAAAAGAATAGGCCGGG - Intergenic
1003479273 6:6516414-6516436 GGAAATGCACAGGGCAGGCCTGG - Intergenic
1003502388 6:6713155-6713177 CAACACGCACAGCAGAGGCCTGG + Intergenic
1003653471 6:7984239-7984261 GAAAATACATAAAAGAGGCTGGG - Intronic
1003670980 6:8159219-8159241 GAATATACACAAAAGAGGCAGGG - Intergenic
1003904277 6:10684662-10684684 GAAAATGTAAAGGAGAGGGCTGG + Intronic
1003956025 6:11165644-11165666 GAAAATGCACATGATAGGCCGGG + Intergenic
1004456600 6:15797302-15797324 GAACATACAAAGAAGAGGCCTGG + Intergenic
1005301465 6:24475377-24475399 TAAAAACCACATAAGAGGCCAGG + Intronic
1005626642 6:27668826-27668848 AAAAATGAAAAGAACAGGCCGGG + Intergenic
1005861151 6:29902260-29902282 GAAAATTGACAAAATAGGCCGGG + Intergenic
1006531795 6:34661828-34661850 TAAAAGACATAGAAGAGGCCAGG + Intronic
1006740596 6:36305668-36305690 GAAAATCCCCTGAAGGGGCCTGG - Intronic
1007153442 6:39718446-39718468 GAAAAAGCAAAGCAGGGGCCAGG + Intronic
1007355496 6:41312531-41312553 GAAAATAAAGAGAACAGGCCAGG + Intergenic
1007459005 6:42003228-42003250 AAAAAAGAACAGCAGAGGCCAGG + Intronic
1007835712 6:44672083-44672105 GAAAATGCAATGGAAAGGCCAGG + Intergenic
1009401386 6:63260107-63260129 AGAAATGCACAGAAGAGGCCGGG - Intergenic
1009505673 6:64475254-64475276 GTAAATGAAAAGAAAAGGCCGGG + Intronic
1010257027 6:73770447-73770469 GAAAATTCCCAGCAGGGGCCAGG + Intronic
1010309363 6:74365815-74365837 GAAAATTCCCAGGATAGGCCAGG + Intergenic
1010809410 6:80281816-80281838 GAAAATGGAAAAAAGAGGTCAGG - Intronic
1011095588 6:83658446-83658468 GAAAATGCAGAAAATTGGCCGGG + Intronic
1011252357 6:85385437-85385459 GAAAATACACAAAATTGGCCAGG + Intergenic
1011484694 6:87829681-87829703 GATAAAGAAGAGAAGAGGCCTGG - Intergenic
1013392418 6:109699797-109699819 CAAAATGCACATGAGAGGCCAGG - Intronic
1013776782 6:113687613-113687635 GAAAATGTATGGAAGGGGCCAGG + Intergenic
1014256382 6:119163589-119163611 GAAATACCAAAGAAGAGGCCAGG - Intergenic
1014832488 6:126119372-126119394 GAAACTGCCCTGGAGAGGCCAGG - Intergenic
1015153325 6:130063090-130063112 GAAGATTCAGAGAAGAGGCCTGG + Intronic
1015563704 6:134543727-134543749 GAAAATGAAGAGAAATGGCCAGG + Intergenic
1015895153 6:138009918-138009940 GAAAATTCTTAGAAGTGGCCAGG - Intergenic
1015933359 6:138384413-138384435 GAAAAATCACTGAGGAGGCCAGG - Intergenic
1017063977 6:150511540-150511562 GAAACTGCACTTAAAAGGCCTGG + Intergenic
1017071097 6:150576220-150576242 GTGAATGCAAAGAAGAGGCCGGG + Intergenic
1017501668 6:155031425-155031447 GAAAATGAAGAGATGAGGCTGGG + Intronic
1019863132 7:3679269-3679291 GAAAATGGGCAAAGGAGGCCAGG + Intronic
1020652963 7:10897139-10897161 AAAAATGAGCAAAAGAGGCCCGG + Intergenic
1020761097 7:12269250-12269272 GAAAATGCAGACAGGAGGCATGG + Intergenic
1020917635 7:14216428-14216450 GAAAATGCATATAGCAGGCCGGG + Intronic
1021939689 7:25667513-25667535 AAAAATAGAGAGAAGAGGCCAGG + Intergenic
1022182079 7:27930288-27930310 GAAAATGCAGAAAATTGGCCGGG - Intronic
1022498657 7:30868943-30868965 GAAAACTCACAGAATAGGCTTGG - Intronic
1022928603 7:35084177-35084199 AAAAATGGACAAAACAGGCCGGG - Intergenic
1023041468 7:36176359-36176381 GAAGAAGCAAAGAAGAGGCAGGG + Intronic
1023087464 7:36585763-36585785 GAAAATACACAGAAAGGGCCTGG + Intronic
1023105509 7:36759838-36759860 TAAAATGGACAGCAGAGACCGGG - Intergenic
1023377601 7:39574300-39574322 TAAAAAGTACAGAAGGGGCCAGG + Intronic
1023613575 7:41995696-41995718 GAAAATGCACAGAAGAGAAGGGG + Intronic
1026052001 7:66954694-66954716 AAAAATACACAAAAGAGGGCTGG - Intronic
1026059666 7:67014993-67015015 AAAAAAAAACAGAAGAGGCCGGG - Intronic
1026069833 7:67108976-67108998 GAAAATATACTGATGAGGCCGGG + Intronic
1026718430 7:72810010-72810032 AAAAAAACACAGAAGAGGCTGGG + Intronic
1026770106 7:73190896-73190918 GATAATGGACAGAAGTGCCCCGG - Intergenic
1026796337 7:73368315-73368337 GAAAAACCACAGTTGAGGCCAGG + Intergenic
1026993824 7:74603138-74603160 GAAAATGCAAAAATGAGGCCGGG + Intergenic
1027010973 7:74744280-74744302 GATAATGGACAGAAGTGCCCCGG - Intronic
1027077068 7:75201760-75201782 GATAATGGACAGAAGTGCCCCGG + Intergenic
1027768924 7:82381861-82381883 GCAAATGCAAATAAGAGGCCGGG - Intronic
1027931274 7:84538031-84538053 GAAAATGTAAAGAGGCGGCCTGG - Intergenic
1029035335 7:97513983-97514005 CAGAATGCACAGAAGGGGCATGG - Intergenic
1029162580 7:98563216-98563238 GAAAATGCACAGAACAGCCTGGG - Intergenic
1029209524 7:98894929-98894951 GAAAAAGGAAAGAACAGGCCAGG - Intronic
1029427819 7:100507840-100507862 TAAAATGCAAAGAACAGGCTGGG + Intergenic
1029824717 7:103177855-103177877 AAAAATGGACAAAACAGGCCGGG - Intergenic
1031269727 7:119633367-119633389 AAAAATGTAGAGAAGAGGACAGG - Intergenic
1032675219 7:134123981-134124003 CAGAATGGAAAGAAGAGGCCAGG - Intergenic
1033319874 7:140329864-140329886 CTAAAGGCACAGAAGAGGCAAGG + Intronic
1033367377 7:140681914-140681936 GACAAAGCACTTAAGAGGCCGGG - Intronic
1033373679 7:140736362-140736384 AAAAAGGTACTGAAGAGGCCAGG - Intronic
1033507462 7:142019771-142019793 TAAAATGCAAAGCATAGGCCAGG + Intronic
1033814137 7:145051757-145051779 GAAAAGGCACTGAAGGGGCTAGG - Intergenic
1033870993 7:145752660-145752682 GAAAATAAAAAAAAGAGGCCAGG + Intergenic
1033925349 7:146452200-146452222 CAAAATATATAGAAGAGGCCGGG - Intronic
1034502125 7:151457525-151457547 GAAGATGCTCAGAAGAAGACAGG - Intergenic
1035317090 7:158002997-158003019 GAAAGAGCACAGGAGAGGGCAGG + Intronic
1036157588 8:6357042-6357064 GAAAAGGCACTGGAGGGGCCGGG - Intergenic
1036663615 8:10725015-10725037 GAATATGCACAGTCTAGGCCGGG - Intergenic
1036929773 8:12944384-12944406 AAAAATATATAGAAGAGGCCAGG + Intergenic
1037479715 8:19293030-19293052 GAAAATGGACAGAATGGGCCAGG - Intergenic
1038064828 8:23952726-23952748 GAAAAAGGGCAGAAGAGGCTGGG + Intergenic
1038270774 8:26073660-26073682 TAAAATGCAGATAATAGGCCGGG - Intergenic
1038309578 8:26435998-26436020 AAAAATACAAAAAAGAGGCCAGG - Intronic
1038562304 8:28590993-28591015 GAAAATGCATTGAGGAGGCTGGG - Intergenic
1038656872 8:29460861-29460883 GAAAGTGCCCAGTTGAGGCCAGG + Intergenic
1039099449 8:33925098-33925120 CAAAGAGCCCAGAAGAGGCCAGG - Intergenic
1039114360 8:34075590-34075612 GAAAAAGCACTGATCAGGCCGGG - Intergenic
1039855510 8:41408780-41408802 GAAAATGATCAGAAAAGGCGGGG - Intergenic
1039989219 8:42473873-42473895 GAAAATGCATATAAAAGGCCGGG + Intronic
1040082020 8:43295027-43295049 GAAAGTTCACAGAAGAGGCCAGG - Intergenic
1040511332 8:48098917-48098939 GAAAATACACAGAGAAGGCTGGG - Intergenic
1041289760 8:56297570-56297592 GCAAATGCACAGAAGGAGCTTGG + Intergenic
1041340682 8:56842618-56842640 GAAACTGCATAGAAAAGGTCAGG + Intergenic
1042365663 8:67933733-67933755 GAAAATACACAGAAGAGAGAAGG + Intergenic
1042684659 8:71424963-71424985 GAAAATGCACATTTTAGGCCGGG + Intronic
1042908895 8:73804059-73804081 GAAAACACAAAGAAGTGGCCGGG - Intronic
1042988241 8:74607314-74607336 AAAAATACACATAACAGGCCAGG + Intronic
1043420345 8:80091173-80091195 TAAAATACACAAAAGAGGCTGGG + Intronic
1044121415 8:88401154-88401176 GAAACTGCACTGAAGAAGCCTGG - Intergenic
1044997713 8:97853027-97853049 GAAAAAGGACATAAGAGACCTGG - Intergenic
1045029708 8:98123481-98123503 TAAAATACACATAAGAGACCAGG + Intronic
1045069653 8:98488740-98488762 GAAAATGCAGAGAAGTGGTATGG + Intronic
1045223179 8:100218085-100218107 GAAAAAGCAGAGAACTGGCCAGG - Intronic
1045338503 8:101231014-101231036 AAAATTGGACAGGAGAGGCCGGG + Intergenic
1045526587 8:102945657-102945679 GAAAATAGACATAAGAGGCTGGG + Intronic
1045553494 8:103193407-103193429 GAAAATGGAGAAAAGAGGCAGGG - Intronic
1046326807 8:112659071-112659093 TAAAATGCACGGAAGAGTCAGGG + Intronic
1047621973 8:126617132-126617154 TAAAATCGAGAGAAGAGGCCCGG - Intergenic
1047715484 8:127591230-127591252 GAAAATGGAGAGAAGAGGAATGG + Intergenic
1048290485 8:133177664-133177686 GAAAATGAAAAGAAGAGGAGAGG - Intergenic
1048369280 8:133763677-133763699 GAGCATGCAAAGCAGAGGCCAGG + Intergenic
1048592379 8:135832846-135832868 GAGGATGTACAGAAGTGGCCAGG - Intergenic
1048885279 8:138904430-138904452 GAGGATGCACACAAGAGGACAGG + Intronic
1049035745 8:140074507-140074529 GGAGATGCACAGAAGATGGCAGG + Intronic
1049866538 8:144941950-144941972 AAAAATGGACACAAGAGGCCAGG - Intronic
1050427405 9:5525751-5525773 TAAAAAGTAAAGAAGAGGCCGGG + Intronic
1050584669 9:7098229-7098251 AAAAATGGACAGAGGTGGCCAGG - Intergenic
1051683105 9:19628161-19628183 TAAAATGCAATTAAGAGGCCTGG + Intronic
1052509059 9:29390923-29390945 GAACAGGAACAGGAGAGGCCAGG + Intergenic
1052763486 9:32616964-32616986 TAAAAAGGATAGAAGAGGCCAGG + Intergenic
1052879958 9:33595685-33595707 GAAAATGCACAGATGCAGCTTGG + Intergenic
1052967897 9:34354884-34354906 AAAAATGCTCACAATAGGCCGGG - Intergenic
1053106305 9:35411758-35411780 GAAAATAGAAAGGAGAGGCCCGG - Intergenic
1053420176 9:37972365-37972387 TAAAATGCACAGGGGAGACCTGG + Intronic
1053496015 9:38548535-38548557 GAAAATGCACAGATGCAGCTTGG - Intronic
1054354919 9:64051051-64051073 GAAAAGCCACGGAAGAGGCAGGG - Intergenic
1055349932 9:75376187-75376209 TAAAAGGAACAGAAGAGGCCGGG - Intergenic
1056338688 9:85602747-85602769 GGAAATGCACTGAAGAGGGTAGG + Intronic
1056586124 9:87928346-87928368 GAAAATGCACAGATGCAGCTTGG - Intergenic
1056610758 9:88124597-88124619 GAAAATGCACAGATGCAGCTTGG + Intergenic
1056648576 9:88437058-88437080 AAAAAGACACAGAGGAGGCCGGG - Intronic
1057104768 9:92402792-92402814 GAAAATACATAGAAGAGTACTGG - Intronic
1057356904 9:94339535-94339557 GAAAATGCTCACTATAGGCCAGG - Intergenic
1057408695 9:94797136-94797158 TAAAAAGCACAGAATTGGCCAGG + Intronic
1057650847 9:96918104-96918126 GAAAATGCTCACTATAGGCCAGG + Intronic
1057675944 9:97136053-97136075 GAAAATGCACAGATGCAGCTTGG - Intergenic
1057787346 9:98096811-98096833 GAAGATGGACAGAGGAGGCCAGG - Intronic
1057955576 9:99404702-99404724 GAAAATGCAGGTAAGGGGCCAGG - Intergenic
1058491508 9:105505552-105505574 GAAAATTCAAAAAACAGGCCAGG - Intronic
1058745008 9:107981911-107981933 GAAAATGCATGGATGAGGCTGGG - Intergenic
1058798442 9:108520905-108520927 GTAATTGCACAGAAGATGCATGG - Intergenic
1058873155 9:109219647-109219669 GAAAATGGACAAAGGTGGCCAGG - Intronic
1059204386 9:112450332-112450354 AAAAAAGCATAGAACAGGCCAGG + Intronic
1059237123 9:112770464-112770486 GCAAAAGCAAAAAAGAGGCCAGG - Intronic
1059756475 9:117298182-117298204 AGAAATGCACATAACAGGCCAGG - Intronic
1060491465 9:124088293-124088315 CAGAAGGCACAGATGAGGCCAGG - Intergenic
1060850889 9:126874343-126874365 GAACATACATAGCAGAGGCCGGG - Intronic
1061476360 9:130869604-130869626 TAACAAGCACAGAAGAGACCAGG + Intronic
1061569828 9:131470359-131470381 GAAAATGGATTGAAGAGGCCTGG + Intronic
1061686646 9:132285885-132285907 AAAAAAACACAAAAGAGGCCAGG + Intronic
1062103905 9:134742317-134742339 GAAAAGGCACAGACCAGGCACGG + Intronic
1062559956 9:137137039-137137061 GAAAATGCAGAGCAGAATCCAGG + Intergenic
1203743259 Un_GL000218v1:20180-20202 GAAAAGCCACGGAAGAGGCAGGG - Intergenic
1203703480 Un_KI270742v1:14841-14863 GAAAAGCCACGGAAGAGGCAGGG - Intergenic
1185602456 X:1349605-1349627 TAAAAAACAAAGAAGAGGCCAGG - Intronic
1185837889 X:3361785-3361807 TAAAATGCTCACATGAGGCCAGG - Intergenic
1186550248 X:10497328-10497350 GAAAGTGCGCAGAAGGGCCCAGG - Intronic
1186637516 X:11422356-11422378 GAAAGGGCACAGATGTGGCCAGG + Intronic
1186801470 X:13096582-13096604 AAAAATATACAGAGGAGGCCGGG - Intergenic
1186922488 X:14297431-14297453 GCAAATGATCAGAAGAGGTCTGG + Intergenic
1187131947 X:16511753-16511775 GAAGATGCCCAGGAGAGGCAGGG + Intergenic
1187194147 X:17065878-17065900 TAAAACTCTCAGAAGAGGCCAGG - Intronic
1187750320 X:22456435-22456457 GAAAATGTAAGGATGAGGCCGGG + Intergenic
1188011998 X:25066573-25066595 GAAAATGAAAATAAGTGGCCGGG - Intergenic
1188356485 X:29198002-29198024 TAAAATGGGTAGAAGAGGCCGGG - Intronic
1188736998 X:33729039-33729061 GAAAAACCACAAAAGAGGACAGG + Intergenic
1189219558 X:39359546-39359568 GCCACTGCACAGAAGAGGCTAGG + Intergenic
1189480309 X:41387559-41387581 TAAAATGTCCAGAATAGGCCGGG + Intergenic
1189913841 X:45837718-45837740 GAAAATGCATAGTATTGGCCGGG + Intergenic
1190017053 X:46836396-46836418 GAAAGAGCACAGAAGAGGATTGG + Intergenic
1191257144 X:58284465-58284487 GCAAATCCAAAGAGGAGGCCAGG - Intergenic
1192139496 X:68635591-68635613 GAAAATATATAGAAAAGGCCTGG + Intergenic
1192470530 X:71394990-71395012 GAAAATGCACATTTAAGGCCAGG - Intronic
1192504171 X:71670795-71670817 GAAAAGGCACAGAAGGCTCCAGG - Intergenic
1193492546 X:82166966-82166988 AAGAATGAACAGAAGAGGCTGGG + Intergenic
1194388911 X:93292344-93292366 GAAAAGGCACTGAAGAGGGTAGG + Intergenic
1196360042 X:114842613-114842635 CAGAATGCTCAGAAGAAGCCTGG + Intronic
1196780432 X:119378675-119378697 CAAAATACCTAGAAGAGGCCGGG + Intergenic
1196841945 X:119867131-119867153 CAAAATTCACAGAAAAGGCTGGG + Intergenic
1197893910 X:131290655-131290677 GAAAATGTACATAAAAGGCTGGG - Intronic
1198433428 X:136590988-136591010 AAAAATACAAAAAAGAGGCCTGG + Intergenic
1198505020 X:137292849-137292871 GAAAGTGCACAGATGAGCCAAGG + Intergenic
1201156788 Y:11137648-11137670 GAAAAGCCACGGAAGAGGCAGGG - Intergenic
1201983755 Y:19938798-19938820 AAAAATACATAGAATAGGCCGGG + Intergenic