ID: 972170714

View in Genome Browser
Species Human (GRCh38)
Location 4:36342353-36342375
Sequence GTTCAGTAATGGAAGGCAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 230
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 209}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972170714 Original CRISPR GTTCAGTAATGGAAGGCAGA TGG Intronic
900200182 1:1401159-1401181 ATGCAGTGATGGAAGCCAGAAGG + Intronic
900924921 1:5699017-5699039 GTGTAGGAATGGAAGGGAGAGGG - Intergenic
904045562 1:27606229-27606251 GTTAAGTAATGAGATGCAGAGGG + Intergenic
904287171 1:29460254-29460276 GTTCAGGAAGGGGAGGCTGAGGG + Intergenic
907558356 1:55365498-55365520 TTTCACTGATGGAAAGCAGAGGG - Intergenic
908034499 1:60037478-60037500 ATTCTGTGGTGGAAGGCAGAAGG + Intronic
909932579 1:81514416-81514438 GTTCAGCACTGCAAGGCACAAGG - Intronic
910268248 1:85364248-85364270 GTACAGAATTGGAAGGCAGAAGG - Intronic
910300408 1:85700591-85700613 TCTCAGTAATGAAAAGCAGATGG - Intronic
911584326 1:99672891-99672913 GTTCATTAAAAGAAGGCAGAAGG - Intronic
915564080 1:156704391-156704413 GTGCAGGAATTGAAGGCAGCAGG + Intronic
916168144 1:161981445-161981467 GAGCAGAAACGGAAGGCAGAGGG - Intergenic
916930247 1:169570373-169570395 GTTCAGCAATGTAAAGAAGAAGG - Intronic
919335637 1:196228747-196228769 GTTAAGTAATGGAAGAATGATGG - Intronic
920662143 1:207924074-207924096 GTTGAGCAAGGGGAGGCAGAGGG + Intergenic
923672872 1:236055706-236055728 GTTCAGCAAAGAAAGGCAAATGG + Intronic
1063591005 10:7395349-7395371 CTTCAGCGATGGAAGCCAGACGG - Intronic
1063651703 10:7944636-7944658 GGTCAGTAATGGAATACAAAGGG + Intronic
1064723632 10:18255306-18255328 GTTCACTAAAGGCAGGGAGAGGG - Intronic
1065903523 10:30228628-30228650 GTGCAGAAATGGAGGGCAAATGG - Intergenic
1065921444 10:30396847-30396869 GTGCAGTGGTGGGAGGCAGACGG - Intergenic
1067433821 10:46263832-46263854 GTTCAGGGATGGTAGGGAGAGGG - Intergenic
1067439863 10:46302475-46302497 GTTCAGGAATGGTAGGGAGAGGG + Intronic
1068120531 10:52779134-52779156 GAGCAGCAAAGGAAGGCAGAGGG + Intergenic
1068503404 10:57868639-57868661 TTGCAATAATGGAAGCCAGAAGG + Intergenic
1071806341 10:89125005-89125027 GTTCAAATTTGGAAGGCAGATGG + Intergenic
1072386936 10:94940325-94940347 ATTTAGTAATGGTAGGAAGAAGG + Intronic
1072889983 10:99315461-99315483 GTTTAACAATGGAAGGAAGAAGG + Intergenic
1072900914 10:99405931-99405953 GGTCAGTGATGGAGGGCAAAGGG + Intronic
1074864215 10:117535560-117535582 GTTTAGGACTGGAAGGCGGAGGG - Intergenic
1076255149 10:129017323-129017345 GTGGAGTAATGCAAGTCAGATGG - Intergenic
1077552159 11:3205340-3205362 GTGCACTAATAGAAGTCAGAGGG + Intergenic
1078410164 11:11108060-11108082 GTGCTGTCATGGAAGGGAGAAGG + Intergenic
1078857051 11:15214887-15214909 ATTCTGTAGTGGAAGGCAGAAGG - Intronic
1079002595 11:16770356-16770378 TGTCTGAAATGGAAGGCAGAGGG + Intergenic
1080538597 11:33245111-33245133 GTTCAGAAAGGGAAGGGATATGG + Intergenic
1083794079 11:65004512-65004534 GCCCTGTAGTGGAAGGCAGATGG - Intergenic
1084195143 11:67520231-67520253 ATTCACGAAGGGAAGGCAGAGGG - Intronic
1085095612 11:73758518-73758540 CTTCAGTAATGGAGGGGGGAGGG + Intronic
1086017594 11:82185179-82185201 GATCATTAATGGAAAGCAGTGGG - Intergenic
1087436254 11:98121989-98122011 GTTCATTAATGTAAGTCAGGGGG + Intergenic
1088740769 11:112765182-112765204 GTTCAATAATACAATGCAGATGG + Intergenic
1089651000 11:119912836-119912858 GGTCAGCAGTGAAAGGCAGAGGG + Intergenic
1090415609 11:126538240-126538262 GGTCACTAATAAAAGGCAGATGG - Intronic
1092400350 12:8170757-8170779 GTACATTCATGGAAGGCAGATGG + Intronic
1095699119 12:45173249-45173271 TTTCAGTATTGGGATGCAGAGGG - Intergenic
1096190860 12:49617850-49617872 TTTCAGAAGTGGAAGCCAGATGG + Intronic
1097372953 12:58806517-58806539 CTACAGTAATAGAAGTCAGAAGG + Intronic
1098631942 12:72734007-72734029 ATTCAGCAAAGGAAGACAGAGGG - Intergenic
1106151374 13:27106478-27106500 GTTTATTAATGGAAGGGAAAAGG - Intronic
1106577950 13:30993200-30993222 GTTCAGTCTTGGATGGCAGGTGG + Intergenic
1107464697 13:40638846-40638868 GTTCTGAAATGGAAGGAAGGGGG + Intronic
1107925688 13:45259599-45259621 GTTCAGTAATGGTACTTAGAAGG + Intronic
1108482310 13:50886426-50886448 GTTCAGGGATGGAGGGAAGAGGG + Intergenic
1109183010 13:59236401-59236423 GTCCAGTAAAGGAAGCCATATGG - Intergenic
1112343250 13:98569686-98569708 GTACATTAATGGACTGCAGACGG - Intronic
1112465427 13:99640359-99640381 GTTCACTAATGTTAGGCTGAGGG + Intronic
1114558322 14:23575114-23575136 GTTGGGTAAAAGAAGGCAGAGGG + Intronic
1115534682 14:34362097-34362119 GTGCAGCAATGGAAGGCTTATGG - Intronic
1116377133 14:44217246-44217268 CTTCACTAAAGGAAGGCAGGAGG + Intergenic
1117504251 14:56386350-56386372 CCTCACTAAAGGAAGGCAGAAGG - Intergenic
1117517187 14:56513459-56513481 GTGCCTTAATGGGAGGCAGAAGG - Intronic
1120172133 14:81256831-81256853 TTACAGTCATGGATGGCAGAAGG - Intergenic
1121318629 14:92977429-92977451 GTTCTGTCATGGTAGGTAGATGG - Intronic
1122519532 14:102333785-102333807 GCTCAGACATGAAAGGCAGAGGG - Intronic
1122625364 14:103082847-103082869 GTTGGGTTATTGAAGGCAGATGG + Intergenic
1122625373 14:103082891-103082913 GTTGGGTTATTGAAGGCAGATGG + Intergenic
1126254193 15:46605658-46605680 GTTAAGGAATGAAAAGCAGATGG - Intergenic
1127316773 15:57803137-57803159 GTCCACCAATAGAAGGCAGAGGG + Intergenic
1127324939 15:57885803-57885825 TCTCAGCAATAGAAGGCAGAAGG - Intergenic
1127771704 15:62236677-62236699 ACTCAGCAATGGAGGGCAGAAGG - Intergenic
1128450139 15:67801214-67801236 GTCCAGCAATGAAAGGCAAAGGG + Intronic
1128887932 15:71305411-71305433 GCTCAGGACTGGAAAGCAGAGGG + Intronic
1128990040 15:72252098-72252120 GATCAGGAATGGATGGCAGCAGG + Intronic
1129534387 15:76300116-76300138 ATTAAGCCATGGAAGGCAGAAGG - Intronic
1129869708 15:78932519-78932541 GGTCAGCAGAGGAAGGCAGAAGG - Intronic
1129920033 15:79311790-79311812 TTTCAGTACTCGAAGGCACAAGG - Intronic
1130812210 15:87391821-87391843 ATTGAGGAATGGAAGGCTGAGGG + Intergenic
1130916274 15:88307498-88307520 CTTCCTTAAGGGAAGGCAGAGGG - Intergenic
1130981950 15:88818639-88818661 ACTCAGCAATGGAAGGCAGATGG + Intronic
1134389804 16:13808872-13808894 GCTCATTGTTGGAAGGCAGAGGG - Intergenic
1138175957 16:54898384-54898406 GTTGAGAAGTGGAAGGCAGGAGG + Intergenic
1141485792 16:84339458-84339480 GATCAGTGATCGCAGGCAGATGG + Intergenic
1142063779 16:88048369-88048391 TTTCAGTAATGGAGGAAAGAAGG + Intronic
1142493661 17:294518-294540 GTGCAGAAATGGACGGCAGAGGG + Intronic
1142493815 17:295507-295529 CTGCAGAAATGGAAAGCAGAGGG + Intronic
1142493848 17:295725-295747 CTGCAGAAATGGAAAGCAGAGGG + Intronic
1142493881 17:295943-295965 CTGCAGAAATGGAAAGCAGAGGG + Intronic
1142650569 17:1348661-1348683 GTTCAGCAAGGTGAGGCAGAAGG - Intronic
1143987424 17:10926815-10926837 GTCCAGCAATGGCTGGCAGAGGG - Intergenic
1145931440 17:28688741-28688763 ATTCAGTAATGGAAATCAGTGGG + Intronic
1146497769 17:33338154-33338176 GTTCTGTAATGGCAAGGAGATGG + Intronic
1150781585 17:68127399-68127421 TTGCAGTTGTGGAAGGCAGAAGG + Intergenic
1153225778 18:2898467-2898489 GAGCAGGAAGGGAAGGCAGAGGG + Intronic
1153365868 18:4255196-4255218 GTTCAGTAAGTCATGGCAGAAGG - Intronic
1155308012 18:24498230-24498252 GTTCACTAAGGTGAGGCAGAGGG + Intergenic
1157051953 18:44176514-44176536 GAGCAGGAATGGAAGGTAGACGG + Intergenic
1157317492 18:46604436-46604458 GCTCAGTAATTCAAGTCAGAAGG - Intronic
1157896836 18:51477483-51477505 GCTGAGTTATGCAAGGCAGAAGG - Intergenic
1166702396 19:44889724-44889746 GTTGAGTAATGGAATGGGGAGGG + Intergenic
1166827708 19:45619623-45619645 GGTCAGTAATAGAAAGCCGAAGG - Intronic
927975776 2:27337053-27337075 GTTCATTACTGGCAGGCTGAGGG - Intronic
928079539 2:28297643-28297665 GTTCCTTAATGGAACGCATAAGG - Intronic
931896772 2:66740409-66740431 GTTGAGGAATAGAAGGAAGAGGG + Intergenic
932129277 2:69173221-69173243 GGCCAGTAAGAGAAGGCAGAAGG - Intronic
933884927 2:86710246-86710268 CTTCAGTAATGAAAGGGAAATGG - Intronic
933925246 2:87086442-87086464 CTTCAGTAATGAAAGGGAAATGG + Intergenic
935409370 2:102743419-102743441 GCTCAGGAATGGGAGGCACAGGG + Intronic
938042248 2:128085251-128085273 GTTCAGCCATGAAAAGCAGAGGG - Intergenic
940313911 2:152307430-152307452 GTTCACTGATGGAAGGAAGCTGG - Intergenic
940622135 2:156125415-156125437 CTTCAGTAGGGGAATGCAGAAGG - Intergenic
943384252 2:187182623-187182645 CTACAGTAATGGATAGCAGAGGG - Intergenic
944568764 2:201020574-201020596 GATCAGTGATGGAAGAGAGAAGG + Intronic
947051583 2:226050296-226050318 GTTGAGAAAAGGAAGGCAGGAGG + Intergenic
1172683692 20:36737265-36737287 CTTCAGGAGTGGAAGGCAGGGGG - Intronic
1173285950 20:41671555-41671577 GTTGAGTAAGGGAGGGAAGAAGG - Intergenic
1173636833 20:44567003-44567025 ATTGAGTAATGGAAACCAGAAGG - Intronic
1179838955 21:44057947-44057969 GTGCAGTAATGGAGATCAGAAGG + Intronic
1181568342 22:23752828-23752850 GGGCAGAAATGGGAGGCAGAGGG + Exonic
1181870786 22:25897608-25897630 ATTCAGTATTTGAAGGCAAATGG - Intronic
1181906347 22:26200184-26200206 GTTCAATACTGGAAGAAAGAAGG - Intronic
1182928548 22:34151085-34151107 GTTCAGTGATGAAAGTCAGAGGG + Intergenic
1183506444 22:38211756-38211778 GTGCAGAAATGGAAAGCACATGG - Intronic
949988568 3:9559170-9559192 GTGCAGAAATGGAACTCAGATGG - Intergenic
951089803 3:18559390-18559412 GTTCAGTTATAGAAGACAAACGG + Intergenic
951811050 3:26700595-26700617 GTTCACGAATGTAAGGCAAATGG + Intronic
952121992 3:30256283-30256305 GTTCATTAATGAAATGCTGATGG - Intergenic
954005457 3:47587041-47587063 TCTCAGAAATGGAAGGGAGAAGG + Exonic
955173957 3:56594217-56594239 CTTCTGTACTGGAAGGCAGGTGG - Intronic
955374134 3:58380060-58380082 TTTCAGTAAAAGAAAGCAGAAGG + Intronic
955519107 3:59757540-59757562 GTTCTGTAATGGAATGCAGTAGG + Intronic
957832707 3:85544223-85544245 ATACAGTAAAGGAAGGCTGAAGG + Intronic
959142394 3:102502286-102502308 TTTCAGTAAGGGTAGGCAGAAGG - Intergenic
960274195 3:115708660-115708682 GTGGAGTCATGGTAGGCAGAGGG + Intronic
961050702 3:123743725-123743747 GTTCAGTGGTGGAAGGGATAAGG + Intronic
961475601 3:127144555-127144577 GTACAGTTATGCAAGTCAGAGGG + Intergenic
962035919 3:131651397-131651419 CTTCAGTAATGAAAGGAAAAAGG - Intronic
965967897 3:174518346-174518368 GTCCAGTAATGGGAGGCTTAGGG + Intronic
968261107 3:197324810-197324832 GGCCAGGATTGGAAGGCAGAAGG + Intergenic
968527812 4:1073032-1073054 GTTCAGTTCTGGAAGGCACGGGG - Exonic
968951520 4:3697081-3697103 ATTCAGTAATGGATAGCAGATGG - Intergenic
969108217 4:4824067-4824089 TTGCAGTAAGGGAATGCAGAGGG + Intergenic
969121432 4:4914258-4914280 GATGAGTAATCCAAGGCAGAGGG + Intergenic
969311622 4:6356317-6356339 CCTCACTCATGGAAGGCAGAGGG - Intronic
969639882 4:8390515-8390537 ATTCAGTTATGGACGGAAGAAGG - Intronic
970715077 4:18912455-18912477 TTACAGTGATGGAAGGCAAAGGG - Intergenic
972170714 4:36342353-36342375 GTTCAGTAATGGAAGGCAGATGG + Intronic
972324601 4:38003521-38003543 GTTCTGTACTGAAAGGTAGATGG + Intronic
972884944 4:43474016-43474038 CTTCAGTAAAGGAAGACAGGAGG - Intergenic
974208058 4:58732694-58732716 GTCCTGTTATGGAAGGCAGAAGG - Intergenic
974481310 4:62447299-62447321 ATTCCATAGTGGAAGGCAGAAGG - Intergenic
976224652 4:82786152-82786174 TTTCAGTTATGAAAGGGAGAAGG + Intronic
979544807 4:121927883-121927905 TTTCAGGAATGGAAAGCAGATGG - Intronic
979611753 4:122696877-122696899 CTTAAGTAATAGAAAGCAGAAGG + Intergenic
979843613 4:125478957-125478979 GTTCAGGAAGTGAAGGGAGATGG - Intronic
981061384 4:140428766-140428788 GTTGAATAATAGAAGTCAGAAGG - Intergenic
982073646 4:151717654-151717676 CTCCATTAATGGAAGGCACATGG + Intronic
983540917 4:168908760-168908782 GTTCAGTAATGAAACACAGACGG + Intronic
983593782 4:169442788-169442810 TTTTAGAAAAGGAAGGCAGAAGG + Intronic
984043139 4:174762505-174762527 TTTAAGTACTGGAAGGCATAGGG + Intronic
985131754 4:186745545-186745567 GTGCAGTGATGGCAGGCGGATGG + Intergenic
987812167 5:22851724-22851746 CTTCAGAATTGAAAGGCAGATGG - Intronic
988052605 5:26050496-26050518 GTTCAGTAATGGAAAACAAGAGG + Intergenic
988614872 5:32765674-32765696 GTGCAGTTATGGAAGGAAGGAGG + Intronic
988987762 5:36637362-36637384 GATCAGTAATAAAAGGCATACGG + Intronic
990161859 5:52949903-52949925 ATTCAGGAAAGGAAGGAAGAAGG - Intronic
991517416 5:67453532-67453554 GCTCAGCAATGGAAGGCAAGAGG - Intergenic
994096942 5:95855948-95855970 GTTCAGGGAAGGAGGGCAGAGGG - Intronic
994683655 5:102922273-102922295 GTTAAGGAATGGAAGGTGGATGG + Intronic
995976212 5:118038486-118038508 GATCAGTAATGAAAGGCAAAGGG - Intergenic
998772788 5:145565237-145565259 GTCCAGCAAAGGAAGGCAGGTGG + Intronic
999215786 5:149933848-149933870 GGTCAGGACTGGCAGGCAGATGG - Intronic
1001633367 5:173192848-173192870 GTTCAGGAAAGGAAGACAGATGG + Intergenic
1004505184 6:16241394-16241416 GTTCATTTATGGAAGGCTGGTGG - Intronic
1005814795 6:29541768-29541790 GTGCAGAAATGGAAGGTAGATGG - Intergenic
1006102864 6:31696777-31696799 GTTCACTAATGGAGGTGAGAAGG + Intronic
1010443714 6:75927958-75927980 GATCAGTAAAGCAAGGCATAAGG - Intronic
1011004346 6:82626740-82626762 CTTCATTAATGGGAGCCAGAGGG - Intergenic
1011801094 6:91017100-91017122 ATCCCATAATGGAAGGCAGAGGG + Intergenic
1013918809 6:115375067-115375089 GTTCAGTTATGGAAGTCACGAGG + Intergenic
1015253521 6:131152442-131152464 GTTCAGTAATGAAAAGCACACGG + Intronic
1017021774 6:150145430-150145452 GTTCAGTCATTGTAGGCTGAAGG + Intronic
1017828855 6:158106147-158106169 CTTCATTAATGGAAGGCAGAAGG - Intergenic
1018116801 6:160594230-160594252 GTTCTGTACTAGCAGGCAGATGG + Intronic
1019156229 6:170040618-170040640 GTTCAGAAAAGAAAGGCAAAAGG + Intergenic
1020894326 7:13920605-13920627 AGGCAGTAATGGAAGGCTGAAGG - Intronic
1021980788 7:26053366-26053388 ATTCCATAGTGGAAGGCAGAAGG - Intergenic
1022404780 7:30078670-30078692 TTTCAGTATTGGGATGCAGAGGG + Exonic
1023376909 7:39565824-39565846 GAACAGGAATGGGAGGCAGAAGG + Intergenic
1026649026 7:72198764-72198786 GATCAATACTGAAAGGCAGATGG + Intronic
1028339585 7:89702217-89702239 GTTGGGTAAAGGAAGGCAGTGGG + Intergenic
1035188145 7:157141707-157141729 CTACAGTAATGGAGGTCAGAAGG - Intronic
1035856272 8:2979694-2979716 ATTCAAAAAAGGAAGGCAGAGGG + Intronic
1039585185 8:38701188-38701210 GTTCTGTAATGAAAGGCAATCGG + Intergenic
1040830228 8:51667911-51667933 TTTCAGGCATGGAATGCAGATGG - Intronic
1042170380 8:65985430-65985452 GCCCAGTGCTGGAAGGCAGATGG + Intergenic
1043004017 8:74795989-74796011 GAGCAGCAATGGAAAGCAGAGGG + Intronic
1043351360 8:79364605-79364627 GTTCAGCCATGAAATGCAGATGG - Intergenic
1043598516 8:81912900-81912922 GATCAGTTATGGGAGGGAGAGGG - Intergenic
1043673178 8:82914460-82914482 TTTAAGTAATGGAAAGCTGATGG - Intergenic
1045330309 8:101150283-101150305 GTCCAGGATTGGAAGGCAGCAGG + Intergenic
1045357354 8:101401615-101401637 CTTCAGAAATGCAATGCAGATGG + Intergenic
1048092830 8:131259798-131259820 TTTTAGAAATGTAAGGCAGAGGG - Intergenic
1049263742 8:141653805-141653827 GCTCAGTCTTGGAAGGCACAGGG + Intergenic
1051220152 9:14840048-14840070 GCTCAGAAATGGAAGGCAATAGG - Intronic
1051882660 9:21855633-21855655 GTTCAGGCAGGGAAGGCAGCAGG + Intronic
1052329200 9:27250357-27250379 GTTCCATAATGCAAGGCTGAGGG + Intergenic
1053027683 9:34743897-34743919 GTCCCGTGGTGGAAGGCAGAAGG + Intergenic
1054882847 9:70163164-70163186 GAGCAGAAATGCAAGGCAGATGG - Intronic
1055330030 9:75174086-75174108 GTACAGTGTTGGAAAGCAGAAGG - Intergenic
1055868241 9:80841671-80841693 GGTCATTAATGAAAGGCAGAAGG + Intergenic
1056770634 9:89475602-89475624 GATCAGTAGGGGAATGCAGAGGG - Intronic
1058956968 9:109958221-109958243 GTTCAGTAATATAAGCTAGATGG - Intronic
1059388640 9:113984900-113984922 GTTCAGTAATGGGATACAGGCGG - Intronic
1059850746 9:118336389-118336411 GTTTAGTAATAGAGGGCAAAAGG - Intergenic
1060529473 9:124339896-124339918 GTCCAGGAAGGGAAGACAGAGGG + Intronic
1187589379 X:20699740-20699762 ATGCAGAAATTGAAGGCAGATGG + Intergenic
1188169476 X:26905918-26905940 GTTCAGGAAGGGAAAACAGATGG + Intergenic
1188221204 X:27543653-27543675 GTTCAGCACAGAAAGGCAGAGGG + Intergenic
1189946269 X:46182839-46182861 TAGCAGCAATGGAAGGCAGATGG - Intergenic
1192433080 X:71125747-71125769 GTTCAGGGAGGGAAGGGAGAGGG - Intronic
1193443914 X:81576964-81576986 GTTCAGAAATCGAAGGCCCATGG - Intergenic
1193591609 X:83394870-83394892 ACTCAGTGATGGAAAGCAGAAGG - Intergenic
1194824412 X:98543741-98543763 GTTCACATATGGAAGGCACATGG - Intergenic
1197966712 X:132071156-132071178 TTTAAGAGATGGAAGGCAGAAGG + Intergenic
1198920216 X:141717145-141717167 CCTCAATAGTGGAAGGCAGAAGG + Intergenic
1198956295 X:142135484-142135506 CTTCAGAAAAGGAAGCCAGAAGG + Intergenic
1199272415 X:145899319-145899341 CTGCAGAAATGGAAGGCAGCAGG - Intergenic
1200091221 X:153637024-153637046 GTGCAGTGGTGGAAGGGAGATGG + Intergenic
1200783583 Y:7238626-7238648 ATTCAGGAATGGGAGGCAGCAGG + Intergenic