ID: 972178163

View in Genome Browser
Species Human (GRCh38)
Location 4:36433123-36433145
Sequence GTGCCCACCCAGACTGAGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972178158_972178163 29 Left 972178158 4:36433071-36433093 CCACATTCCTCTGGCTACATTTA No data
Right 972178163 4:36433123-36433145 GTGCCCACCCAGACTGAGAATGG No data
972178161_972178163 5 Left 972178161 4:36433095-36433117 CCTAGCTGCACTGGCAGCTGATT 0: 23
1: 62
2: 111
3: 188
4: 440
Right 972178163 4:36433123-36433145 GTGCCCACCCAGACTGAGAATGG No data
972178159_972178163 22 Left 972178159 4:36433078-36433100 CCTCTGGCTACATTTATCCTAGC No data
Right 972178163 4:36433123-36433145 GTGCCCACCCAGACTGAGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972178163 Original CRISPR GTGCCCACCCAGACTGAGAA TGG Intergenic
No off target data available for this crispr