ID: 972180563

View in Genome Browser
Species Human (GRCh38)
Location 4:36459657-36459679
Sequence CTGTAAACACAGCAGCAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972180557_972180563 13 Left 972180557 4:36459621-36459643 CCCGAAGTGTGAGGCAGGATGTG No data
Right 972180563 4:36459657-36459679 CTGTAAACACAGCAGCAGCCAGG No data
972180558_972180563 12 Left 972180558 4:36459622-36459644 CCGAAGTGTGAGGCAGGATGTGG No data
Right 972180563 4:36459657-36459679 CTGTAAACACAGCAGCAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972180563 Original CRISPR CTGTAAACACAGCAGCAGCC AGG Intergenic
No off target data available for this crispr