ID: 972181670

View in Genome Browser
Species Human (GRCh38)
Location 4:36474522-36474544
Sequence CATGTACAAGATGCCATACT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972181669_972181670 19 Left 972181669 4:36474480-36474502 CCAAATTTTAATTTTCACATGAA No data
Right 972181670 4:36474522-36474544 CATGTACAAGATGCCATACTAGG No data
972181668_972181670 20 Left 972181668 4:36474479-36474501 CCCAAATTTTAATTTTCACATGA No data
Right 972181670 4:36474522-36474544 CATGTACAAGATGCCATACTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972181670 Original CRISPR CATGTACAAGATGCCATACT AGG Intergenic
No off target data available for this crispr