ID: 972187020

View in Genome Browser
Species Human (GRCh38)
Location 4:36541777-36541799
Sequence ACTTGGCTCGCTGAGTCTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972187020_972187027 15 Left 972187020 4:36541777-36541799 CCCCAAGACTCAGCGAGCCAAGT No data
Right 972187027 4:36541815-36541837 CTGATTTATTCTAGTCATGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972187020 Original CRISPR ACTTGGCTCGCTGAGTCTTG GGG (reversed) Intergenic
No off target data available for this crispr