ID: 972195231

View in Genome Browser
Species Human (GRCh38)
Location 4:36646158-36646180
Sequence CGGGCGGTTACACCTTTAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972195231_972195242 27 Left 972195231 4:36646158-36646180 CCCTCTAAAGGTGTAACCGCCCG No data
Right 972195242 4:36646208-36646230 CAGAGCCAATTTATCAACACAGG No data
972195231_972195244 29 Left 972195231 4:36646158-36646180 CCCTCTAAAGGTGTAACCGCCCG No data
Right 972195244 4:36646210-36646232 GAGCCAATTTATCAACACAGGGG No data
972195231_972195243 28 Left 972195231 4:36646158-36646180 CCCTCTAAAGGTGTAACCGCCCG No data
Right 972195243 4:36646209-36646231 AGAGCCAATTTATCAACACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972195231 Original CRISPR CGGGCGGTTACACCTTTAGA GGG (reversed) Intergenic
No off target data available for this crispr