ID: 972197318

View in Genome Browser
Species Human (GRCh38)
Location 4:36669861-36669883
Sequence CTGATCATCAACAAAATTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972197318_972197322 23 Left 972197318 4:36669861-36669883 CCAACAATTTTGTTGATGATCAG No data
Right 972197322 4:36669907-36669929 AAGGCGATTAATCCTGTACCAGG No data
972197318_972197319 4 Left 972197318 4:36669861-36669883 CCAACAATTTTGTTGATGATCAG No data
Right 972197319 4:36669888-36669910 GATCCAGATATACCACGTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972197318 Original CRISPR CTGATCATCAACAAAATTGT TGG (reversed) Intergenic
No off target data available for this crispr