ID: 972199203

View in Genome Browser
Species Human (GRCh38)
Location 4:36693086-36693108
Sequence CTCTCTTACCAGAAGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972199203_972199207 -2 Left 972199203 4:36693086-36693108 CCCTCCTCCTTCTGGTAAGAGAG No data
Right 972199207 4:36693107-36693129 AGCTAGATCTAGACAATCTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972199203 Original CRISPR CTCTCTTACCAGAAGGAGGA GGG (reversed) Intergenic
No off target data available for this crispr