ID: 972201301

View in Genome Browser
Species Human (GRCh38)
Location 4:36717183-36717205
Sequence AGTTATCTGTAGAAGATGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972201296_972201301 11 Left 972201296 4:36717149-36717171 CCCATGATCAAACGTTTAGTTTC No data
Right 972201301 4:36717183-36717205 AGTTATCTGTAGAAGATGGCAGG No data
972201297_972201301 10 Left 972201297 4:36717150-36717172 CCATGATCAAACGTTTAGTTTCC No data
Right 972201301 4:36717183-36717205 AGTTATCTGTAGAAGATGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972201301 Original CRISPR AGTTATCTGTAGAAGATGGC AGG Intergenic
No off target data available for this crispr