ID: 972203883

View in Genome Browser
Species Human (GRCh38)
Location 4:36747872-36747894
Sequence CATGAATGGCAGTGGGAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972203868_972203883 21 Left 972203868 4:36747828-36747850 CCATCCCAGAGCGGGGTCTAAGG No data
Right 972203883 4:36747872-36747894 CATGAATGGCAGTGGGAAGCAGG No data
972203871_972203883 17 Left 972203871 4:36747832-36747854 CCCAGAGCGGGGTCTAAGGGCAC No data
Right 972203883 4:36747872-36747894 CATGAATGGCAGTGGGAAGCAGG No data
972203876_972203883 -9 Left 972203876 4:36747858-36747880 CCAAGCCCTGGGGCCATGAATGG No data
Right 972203883 4:36747872-36747894 CATGAATGGCAGTGGGAAGCAGG No data
972203867_972203883 26 Left 972203867 4:36747823-36747845 CCTCTCCATCCCAGAGCGGGGTC No data
Right 972203883 4:36747872-36747894 CATGAATGGCAGTGGGAAGCAGG No data
972203872_972203883 16 Left 972203872 4:36747833-36747855 CCAGAGCGGGGTCTAAGGGCACA No data
Right 972203883 4:36747872-36747894 CATGAATGGCAGTGGGAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972203883 Original CRISPR CATGAATGGCAGTGGGAAGC AGG Intergenic
No off target data available for this crispr