ID: 972213549

View in Genome Browser
Species Human (GRCh38)
Location 4:36868196-36868218
Sequence ACATATAGGCTTCAGGGAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972213549_972213557 26 Left 972213549 4:36868196-36868218 CCTTCTCCCTGAAGCCTATATGT No data
Right 972213557 4:36868245-36868267 GAGTTTATTCCAGTTGGAGAAGG No data
972213549_972213556 20 Left 972213549 4:36868196-36868218 CCTTCTCCCTGAAGCCTATATGT No data
Right 972213556 4:36868239-36868261 CTGTGAGAGTTTATTCCAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972213549 Original CRISPR ACATATAGGCTTCAGGGAGA AGG (reversed) Intergenic
No off target data available for this crispr