ID: 972215902

View in Genome Browser
Species Human (GRCh38)
Location 4:36896518-36896540
Sequence CTTGTTACTGACAGTTTTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972215902_972215906 14 Left 972215902 4:36896518-36896540 CCAACAAAACTGTCAGTAACAAG No data
Right 972215906 4:36896555-36896577 TCCATCTTCTTTCATGTCCTTGG No data
972215902_972215908 15 Left 972215902 4:36896518-36896540 CCAACAAAACTGTCAGTAACAAG No data
Right 972215908 4:36896556-36896578 CCATCTTCTTTCATGTCCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972215902 Original CRISPR CTTGTTACTGACAGTTTTGT TGG (reversed) Intergenic
No off target data available for this crispr