ID: 972215908

View in Genome Browser
Species Human (GRCh38)
Location 4:36896556-36896578
Sequence CCATCTTCTTTCATGTCCTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972215902_972215908 15 Left 972215902 4:36896518-36896540 CCAACAAAACTGTCAGTAACAAG No data
Right 972215908 4:36896556-36896578 CCATCTTCTTTCATGTCCTTGGG No data
972215901_972215908 16 Left 972215901 4:36896517-36896539 CCCAACAAAACTGTCAGTAACAA No data
Right 972215908 4:36896556-36896578 CCATCTTCTTTCATGTCCTTGGG No data
972215900_972215908 20 Left 972215900 4:36896513-36896535 CCAGCCCAACAAAACTGTCAGTA No data
Right 972215908 4:36896556-36896578 CCATCTTCTTTCATGTCCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972215908 Original CRISPR CCATCTTCTTTCATGTCCTT GGG Intergenic
No off target data available for this crispr