ID: 972217038

View in Genome Browser
Species Human (GRCh38)
Location 4:36909186-36909208
Sequence CAGTCTGAGGAGAGGCAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972217038_972217045 -7 Left 972217038 4:36909186-36909208 CCCTCCTGCCTCTCCTCAGACTG No data
Right 972217045 4:36909202-36909224 CAGACTGGGTATTAGTAAACTGG No data
972217038_972217046 -6 Left 972217038 4:36909186-36909208 CCCTCCTGCCTCTCCTCAGACTG No data
Right 972217046 4:36909203-36909225 AGACTGGGTATTAGTAAACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972217038 Original CRISPR CAGTCTGAGGAGAGGCAGGA GGG (reversed) Intergenic
No off target data available for this crispr