ID: 972218080

View in Genome Browser
Species Human (GRCh38)
Location 4:36919828-36919850
Sequence AAGTGTCTCTTTAATGAACA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972218078_972218080 5 Left 972218078 4:36919800-36919822 CCATCATTCCGCTTGCGCAGTCA No data
Right 972218080 4:36919828-36919850 AAGTGTCTCTTTAATGAACATGG No data
972218079_972218080 -3 Left 972218079 4:36919808-36919830 CCGCTTGCGCAGTCATGTCTAAG No data
Right 972218080 4:36919828-36919850 AAGTGTCTCTTTAATGAACATGG No data
972218076_972218080 20 Left 972218076 4:36919785-36919807 CCCTCAGTTTCATTTCCATCATT No data
Right 972218080 4:36919828-36919850 AAGTGTCTCTTTAATGAACATGG No data
972218077_972218080 19 Left 972218077 4:36919786-36919808 CCTCAGTTTCATTTCCATCATTC No data
Right 972218080 4:36919828-36919850 AAGTGTCTCTTTAATGAACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972218080 Original CRISPR AAGTGTCTCTTTAATGAACA TGG Intergenic
No off target data available for this crispr