ID: 972221783

View in Genome Browser
Species Human (GRCh38)
Location 4:36964244-36964266
Sequence TTCCCACAGCTGGTACATAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972221783_972221789 22 Left 972221783 4:36964244-36964266 CCAGTATGTACCAGCTGTGGGAA No data
Right 972221789 4:36964289-36964311 GCTCCATGTTCAGTGATGCAGGG No data
972221783_972221788 21 Left 972221783 4:36964244-36964266 CCAGTATGTACCAGCTGTGGGAA No data
Right 972221788 4:36964288-36964310 AGCTCCATGTTCAGTGATGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972221783 Original CRISPR TTCCCACAGCTGGTACATAC TGG (reversed) Intergenic
No off target data available for this crispr