ID: 972221789

View in Genome Browser
Species Human (GRCh38)
Location 4:36964289-36964311
Sequence GCTCCATGTTCAGTGATGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972221785_972221789 -2 Left 972221785 4:36964268-36964290 CCAACTGCAAATCACTTCCCAGC No data
Right 972221789 4:36964289-36964311 GCTCCATGTTCAGTGATGCAGGG No data
972221783_972221789 22 Left 972221783 4:36964244-36964266 CCAGTATGTACCAGCTGTGGGAA No data
Right 972221789 4:36964289-36964311 GCTCCATGTTCAGTGATGCAGGG No data
972221784_972221789 12 Left 972221784 4:36964254-36964276 CCAGCTGTGGGAATCCAACTGCA No data
Right 972221789 4:36964289-36964311 GCTCCATGTTCAGTGATGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972221789 Original CRISPR GCTCCATGTTCAGTGATGCA GGG Intergenic
No off target data available for this crispr