ID: 972223886

View in Genome Browser
Species Human (GRCh38)
Location 4:36989468-36989490
Sequence TAAATTTATTTTTTCAGGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972223886_972223894 29 Left 972223886 4:36989468-36989490 CCCCTCCTGAAAAAATAAATTTA No data
Right 972223894 4:36989520-36989542 TTAGGTGGAGCCAGGCACAGTGG No data
972223886_972223891 11 Left 972223886 4:36989468-36989490 CCCCTCCTGAAAAAATAAATTTA No data
Right 972223891 4:36989502-36989524 TTGTGGTTGCTAAAATAATTAGG No data
972223886_972223893 21 Left 972223886 4:36989468-36989490 CCCCTCCTGAAAAAATAAATTTA No data
Right 972223893 4:36989512-36989534 TAAAATAATTAGGTGGAGCCAGG No data
972223886_972223892 14 Left 972223886 4:36989468-36989490 CCCCTCCTGAAAAAATAAATTTA No data
Right 972223892 4:36989505-36989527 TGGTTGCTAAAATAATTAGGTGG No data
972223886_972223890 -6 Left 972223886 4:36989468-36989490 CCCCTCCTGAAAAAATAAATTTA No data
Right 972223890 4:36989485-36989507 AATTTATTCAATTATCATTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972223886 Original CRISPR TAAATTTATTTTTTCAGGAG GGG (reversed) Intergenic
No off target data available for this crispr