ID: 972223888

View in Genome Browser
Species Human (GRCh38)
Location 4:36989470-36989492
Sequence AATAAATTTATTTTTTCAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972223888_972223890 -8 Left 972223888 4:36989470-36989492 CCTCCTGAAAAAATAAATTTATT No data
Right 972223890 4:36989485-36989507 AATTTATTCAATTATCATTGTGG No data
972223888_972223894 27 Left 972223888 4:36989470-36989492 CCTCCTGAAAAAATAAATTTATT No data
Right 972223894 4:36989520-36989542 TTAGGTGGAGCCAGGCACAGTGG No data
972223888_972223893 19 Left 972223888 4:36989470-36989492 CCTCCTGAAAAAATAAATTTATT No data
Right 972223893 4:36989512-36989534 TAAAATAATTAGGTGGAGCCAGG No data
972223888_972223892 12 Left 972223888 4:36989470-36989492 CCTCCTGAAAAAATAAATTTATT No data
Right 972223892 4:36989505-36989527 TGGTTGCTAAAATAATTAGGTGG No data
972223888_972223891 9 Left 972223888 4:36989470-36989492 CCTCCTGAAAAAATAAATTTATT No data
Right 972223891 4:36989502-36989524 TTGTGGTTGCTAAAATAATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972223888 Original CRISPR AATAAATTTATTTTTTCAGG AGG (reversed) Intergenic
No off target data available for this crispr