ID: 972223889

View in Genome Browser
Species Human (GRCh38)
Location 4:36989473-36989495
Sequence TTGAATAAATTTATTTTTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972223889_972223895 28 Left 972223889 4:36989473-36989495 CCTGAAAAAATAAATTTATTCAA No data
Right 972223895 4:36989524-36989546 GTGGAGCCAGGCACAGTGGCAGG No data
972223889_972223892 9 Left 972223889 4:36989473-36989495 CCTGAAAAAATAAATTTATTCAA No data
Right 972223892 4:36989505-36989527 TGGTTGCTAAAATAATTAGGTGG No data
972223889_972223894 24 Left 972223889 4:36989473-36989495 CCTGAAAAAATAAATTTATTCAA No data
Right 972223894 4:36989520-36989542 TTAGGTGGAGCCAGGCACAGTGG No data
972223889_972223893 16 Left 972223889 4:36989473-36989495 CCTGAAAAAATAAATTTATTCAA No data
Right 972223893 4:36989512-36989534 TAAAATAATTAGGTGGAGCCAGG No data
972223889_972223891 6 Left 972223889 4:36989473-36989495 CCTGAAAAAATAAATTTATTCAA No data
Right 972223891 4:36989502-36989524 TTGTGGTTGCTAAAATAATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972223889 Original CRISPR TTGAATAAATTTATTTTTTC AGG (reversed) Intergenic
No off target data available for this crispr