ID: 972223893

View in Genome Browser
Species Human (GRCh38)
Location 4:36989512-36989534
Sequence TAAAATAATTAGGTGGAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972223886_972223893 21 Left 972223886 4:36989468-36989490 CCCCTCCTGAAAAAATAAATTTA No data
Right 972223893 4:36989512-36989534 TAAAATAATTAGGTGGAGCCAGG No data
972223889_972223893 16 Left 972223889 4:36989473-36989495 CCTGAAAAAATAAATTTATTCAA No data
Right 972223893 4:36989512-36989534 TAAAATAATTAGGTGGAGCCAGG No data
972223888_972223893 19 Left 972223888 4:36989470-36989492 CCTCCTGAAAAAATAAATTTATT No data
Right 972223893 4:36989512-36989534 TAAAATAATTAGGTGGAGCCAGG No data
972223887_972223893 20 Left 972223887 4:36989469-36989491 CCCTCCTGAAAAAATAAATTTAT No data
Right 972223893 4:36989512-36989534 TAAAATAATTAGGTGGAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972223893 Original CRISPR TAAAATAATTAGGTGGAGCC AGG Intergenic
No off target data available for this crispr