ID: 972226265

View in Genome Browser
Species Human (GRCh38)
Location 4:37016435-37016457
Sequence CTGTGTACTCACATAGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972226265_972226268 5 Left 972226265 4:37016435-37016457 CCTTCCACTATGTGAGTACACAG No data
Right 972226268 4:37016463-37016485 AGGTGTCATCTGTGAAGAAGTGG No data
972226265_972226269 6 Left 972226265 4:37016435-37016457 CCTTCCACTATGTGAGTACACAG No data
Right 972226269 4:37016464-37016486 GGTGTCATCTGTGAAGAAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972226265 Original CRISPR CTGTGTACTCACATAGTGGA AGG (reversed) Intergenic
No off target data available for this crispr