ID: 972245777

View in Genome Browser
Species Human (GRCh38)
Location 4:37244535-37244557
Sequence GGGCTTGGGCGCGGGGGCCT CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 543
Summary {0: 1, 1: 0, 2: 5, 3: 50, 4: 487}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972245777_972245792 24 Left 972245777 4:37244535-37244557 CCGAGGCCCCCGCGCCCAAGCCC 0: 1
1: 0
2: 5
3: 50
4: 487
Right 972245792 4:37244582-37244604 ATTTCTGCGCCCGAGAGAGGCGG 0: 1
1: 0
2: 0
3: 4
4: 74
972245777_972245793 25 Left 972245777 4:37244535-37244557 CCGAGGCCCCCGCGCCCAAGCCC 0: 1
1: 0
2: 5
3: 50
4: 487
Right 972245793 4:37244583-37244605 TTTCTGCGCCCGAGAGAGGCGGG 0: 1
1: 0
2: 0
3: 5
4: 84
972245777_972245791 21 Left 972245777 4:37244535-37244557 CCGAGGCCCCCGCGCCCAAGCCC 0: 1
1: 0
2: 5
3: 50
4: 487
Right 972245791 4:37244579-37244601 GTTATTTCTGCGCCCGAGAGAGG 0: 1
1: 0
2: 0
3: 1
4: 18
972245777_972245794 30 Left 972245777 4:37244535-37244557 CCGAGGCCCCCGCGCCCAAGCCC 0: 1
1: 0
2: 5
3: 50
4: 487
Right 972245794 4:37244588-37244610 GCGCCCGAGAGAGGCGGGCTCGG 0: 1
1: 0
2: 0
3: 10
4: 156

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972245777 Original CRISPR GGGCTTGGGCGCGGGGGCCT CGG (reversed) Exonic