ID: 972245980

View in Genome Browser
Species Human (GRCh38)
Location 4:37245408-37245430
Sequence GTGTCCTAATAGAAGTGTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 109
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 97}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972245980_972245994 29 Left 972245980 4:37245408-37245430 CCTGCACACTTCTATTAGGACAC 0: 1
1: 0
2: 1
3: 10
4: 97
Right 972245994 4:37245460-37245482 GTCAATCCAAGAAACATCCAAGG 0: 1
1: 0
2: 0
3: 17
4: 158
972245980_972245987 7 Left 972245980 4:37245408-37245430 CCTGCACACTTCTATTAGGACAC 0: 1
1: 0
2: 1
3: 10
4: 97
Right 972245987 4:37245438-37245460 CCACCCCGGGTTATTCCCCTGGG 0: 1
1: 0
2: 0
3: 3
4: 72
972245980_972245985 6 Left 972245980 4:37245408-37245430 CCTGCACACTTCTATTAGGACAC 0: 1
1: 0
2: 1
3: 10
4: 97
Right 972245985 4:37245437-37245459 TCCACCCCGGGTTATTCCCCTGG 0: 1
1: 0
2: 0
3: 4
4: 56
972245980_972245982 -6 Left 972245980 4:37245408-37245430 CCTGCACACTTCTATTAGGACAC 0: 1
1: 0
2: 1
3: 10
4: 97
Right 972245982 4:37245425-37245447 GGACACCCATTCTCCACCCCGGG 0: 1
1: 0
2: 4
3: 16
4: 196
972245980_972245981 -7 Left 972245980 4:37245408-37245430 CCTGCACACTTCTATTAGGACAC 0: 1
1: 0
2: 1
3: 10
4: 97
Right 972245981 4:37245424-37245446 AGGACACCCATTCTCCACCCCGG 0: 1
1: 0
2: 0
3: 16
4: 188

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972245980 Original CRISPR GTGTCCTAATAGAAGTGTGC AGG (reversed) Intronic
907272137 1:53297411-53297433 GTGTCCTGACAGTAGGGTGCAGG + Intronic
913393267 1:118338301-118338323 ATGTCCTAATTGAAGTCTTCAGG + Intergenic
915723510 1:158001530-158001552 GTGCCGTGATAGCAGTGTGCAGG + Intronic
924722791 1:246638800-246638822 GTGTCCACACAGAAGTGTGCAGG + Intronic
1064813393 10:19228678-19228700 GTGTTCTAATTGAAATGTGTTGG - Intronic
1065524029 10:26599838-26599860 CTGTCCTAATAGAAGTATGTAGG - Intergenic
1065546290 10:26825012-26825034 GAGTCCTAATATTTGTGTGCTGG + Intronic
1067083167 10:43223275-43223297 GTCCCCAAATAGAAGTGTGCAGG + Intronic
1068945327 10:62723777-62723799 GTGGCCCAGTAGAAGTGTGGTGG + Intergenic
1070045432 10:72829961-72829983 GTGTCATTATAGAAGTAGGCGGG + Intronic
1070429912 10:76327479-76327501 CTGGCCTAATATAAGTGTGTAGG - Intronic
1071743537 10:88389293-88389315 GTCTCCTAACAGAACTGTGCTGG + Intronic
1073895866 10:108156740-108156762 GTTTCCTAAAAGAAGAGTGGAGG + Intergenic
1074355882 10:112782664-112782686 GTGTCCGATGAGAAGTCTGCAGG - Intronic
1083050051 11:59769041-59769063 GTTTCCCAATACATGTGTGCAGG - Intronic
1087048690 11:93865729-93865751 GTGTCTACATAGAAGTGTGCAGG + Intergenic
1098319843 12:69232225-69232247 ATGTCCAGATAGAAGTCTGCTGG + Intergenic
1099861846 12:88231865-88231887 GTGTCTACACAGAAGTGTGCAGG - Intergenic
1102826360 12:115950742-115950764 GTGTCCTCATAGTGGTGTGGAGG + Intergenic
1103036636 12:117662259-117662281 GTGTCTTGACAGAAGTTTGCTGG - Intronic
1104337400 12:127912463-127912485 GTGTCATAAATGAAATGTGCTGG + Intergenic
1107328243 13:39268777-39268799 GTGTATTAATAGAAATGTGGAGG + Intergenic
1115517186 14:34197640-34197662 GTGTCCTATTTGAAGTTTCCTGG - Intronic
1116057341 14:39880118-39880140 GGGTCCTAATAGAATATTGCTGG - Intergenic
1116400018 14:44495275-44495297 TTGTGCTAATAGAAGTGTGAGGG - Intergenic
1121174281 14:91879168-91879190 GTTTCCTAAAAGAAGTTTGGAGG + Intronic
1125921247 15:43527090-43527112 GTGCCCCAAGAGAAGGGTGCAGG - Exonic
1128889143 15:71315342-71315364 GTGTCATAATAAAAGTGTGAAGG - Intronic
1131703801 15:94970873-94970895 GTGTGCTGATAGAAGTGAGTGGG + Intergenic
1135396738 16:22137405-22137427 GTCTCATAATGGAAGGGTGCTGG + Intronic
1137071195 16:35906307-35906329 GTGTCTACACAGAAGTGTGCAGG + Intergenic
1144424220 17:15126146-15126168 CTCTTCTAATAGATGTGTGCTGG - Intergenic
1146841894 17:36162033-36162055 TTCTCCTAAGAGGAGTGTGCAGG - Intergenic
1146854205 17:36249993-36250015 CTCTCCTAAGAGGAGTGTGCAGG - Intronic
1146870108 17:36373885-36373907 CTCTCCTAAGAGGAGTGTGCAGG - Intronic
1146877465 17:36424966-36424988 CTCTCCTAAGAGGAGTGTGCAGG - Intronic
1147072989 17:37974509-37974531 CTCTCCTAAGAGGAGTGTGCAGG - Intergenic
1147084511 17:38054047-38054069 CTCTCCTAAGAGGAGTGTGCAGG - Intronic
1147100458 17:38178013-38178035 CTCTCCTAAGAGGAGTGTGCAGG - Intergenic
1150083399 17:62261059-62261081 TTCTCCTAAGAGGAGTGTGCAGG - Intergenic
1151444433 17:74153910-74153932 GGGTCCTCAGAGAAGTGAGCTGG - Intergenic
1153440149 18:5108150-5108172 GTCTACCAATAGAAGTGTCCAGG - Intergenic
1156875171 18:42001800-42001822 CAGTCTTAATAGAAATGTGCGGG - Intronic
1157492514 18:48134363-48134385 CTGTCCTAATAGAATGGTGTTGG - Intronic
1158629115 18:59096627-59096649 GTGTCCAAATGGAAGCATGCAGG - Intergenic
1167534474 19:50041027-50041049 GTAACATAATAAAAGTGTGCTGG - Intronic
1168049695 19:53819990-53820012 GTGTGCCAGTAGTAGTGTGCTGG - Intronic
925228960 2:2213453-2213475 GTCTCCTCATAGACTTGTGCTGG - Intronic
926368390 2:12154941-12154963 GTGTCCTAATAGGTGTGTTGTGG + Intergenic
927553076 2:24015938-24015960 GAGTACTAATGGGAGTGTGCAGG + Intronic
933167804 2:79094863-79094885 GTGTTCAAACAGAAGTGTGTAGG + Intergenic
934853524 2:97715619-97715641 GTCTCCTAATAGACATTTGCTGG + Intronic
935302548 2:101705393-101705415 GTGTCTGAACACAAGTGTGCTGG - Intronic
937032207 2:118750133-118750155 GTGTGCTAATGGAAGAGTTCAGG - Intergenic
938111681 2:128571806-128571828 GTGCCCTAATTGAAGAGGGCTGG - Intergenic
947399669 2:229718452-229718474 GGGTCCTGATAGAACTGTTCTGG - Intergenic
947562333 2:231167293-231167315 GTGTCCTAATACATCTGTTCTGG - Intronic
1172445664 20:34992038-34992060 GTGTCCACTTAGAAGTGGGCAGG + Intronic
1174396887 20:50252174-50252196 ATGACCTAAGAGAAGGGTGCTGG + Intergenic
1177337431 21:19749446-19749468 TTGTCCCACTAGAAGTCTGCAGG - Intergenic
1178531307 21:33378571-33378593 CTGTCCTAATAGAAGGAAGCTGG - Intergenic
1179667149 21:42920791-42920813 GTGTCCACACAGAAGTGTGCAGG + Intergenic
1183865613 22:40701906-40701928 GTATCCTCACAGAAGTGTGCAGG - Intergenic
951420368 3:22476779-22476801 TTGTCCTAACAGAACTGTGGGGG + Intergenic
956153590 3:66269531-66269553 GATTCCTAATGGAAGTGTGTTGG + Intronic
956277568 3:67519405-67519427 GTGTAACATTAGAAGTGTGCTGG + Intronic
961042316 3:123686228-123686250 GTGTCCCCAAAGAAGTGTGGGGG + Intronic
964384569 3:156133660-156133682 GTGTGATATTAGAAGTGTGAAGG + Intronic
964413595 3:156424876-156424898 GTGTCTTATTACAAGTGTTCAGG - Intronic
967215593 3:187207339-187207361 GTGTCCTCAGAGTACTGTGCTGG + Intergenic
971764863 4:30817848-30817870 GTGTTTTAAAAGAAGTGTTCTGG - Intronic
972245980 4:37245408-37245430 GTGTCCTAATAGAAGTGTGCAGG - Intronic
973976223 4:56265092-56265114 CTGTCATAATGGAAATGTGCTGG + Intronic
974412487 4:61560129-61560151 GTGCCATAATAGAAGTATGGAGG - Intronic
974439185 4:61895069-61895091 GAGTCTTAAAATAAGTGTGCAGG - Intronic
976661962 4:87548973-87548995 GTGTCCTAGCAGAAGTAAGCAGG - Intergenic
984886212 4:184452086-184452108 GTCTCCAAATAGAGGTGTGAAGG - Intronic
990354947 5:54957814-54957836 GAGACCTACTAGAAGTGTGGTGG - Exonic
990547412 5:56836752-56836774 GTCCCCTAAAAGAAGTATGCTGG - Intronic
994868415 5:105310631-105310653 GTGTTCTAGTAGAAGTTAGCAGG - Intergenic
996353100 5:122567457-122567479 GTGTCAGAAAAGAAGTGTGGTGG - Intergenic
997575014 5:134968124-134968146 ATGTGCTAGTAGAAGTGTGAGGG + Exonic
998958717 5:147463147-147463169 GTGTGCTAACAGAAAGGTGCTGG - Intronic
1007965224 6:45998286-45998308 GTGTCCTAACATCTGTGTGCTGG - Intronic
1012779611 6:103540897-103540919 GTGTACTAAAAGAAATGTGTTGG - Intergenic
1015750410 6:136552948-136552970 GTATCTTGATAGAATTGTGCAGG - Intergenic
1024082458 7:45866313-45866335 AGGTCCTGAGAGAAGTGTGCAGG + Intergenic
1033910240 7:146254535-146254557 GTGTCCTATTAGAAGTGTTCAGG + Intronic
1043823639 8:84898870-84898892 GTGTCCTAACAGAGGTTTGCAGG - Intronic
1043970446 8:86522863-86522885 GTGTCCTAAAACAATTGTGAAGG - Intronic
1045368069 8:101494036-101494058 GCGTCCTATTGGAAGTGCGCGGG + Intronic
1050694280 9:8261658-8261680 GTTCCCTAATAGGAGTTTGCTGG + Intergenic
1051021114 9:12544105-12544127 GAGTGCTAAGAGAAGTGTGAGGG - Intergenic
1052651333 9:31306552-31306574 GAATCTTAATAGAAGTGTGTGGG - Intergenic
1055994489 9:82142533-82142555 GTGTTCTAAAAGAAGTCTGTGGG - Intergenic
1059968511 9:119640165-119640187 CTGTCCGAATAAATGTGTGCTGG + Intergenic
1061682708 9:132250843-132250865 GTGGCCTAGAAGGAGTGTGCAGG + Intergenic
1186884774 X:13902572-13902594 GTGGCAGAATAGAAGAGTGCTGG - Intronic
1187254035 X:17625210-17625232 GTGGCTTAATAGAAGACTGCTGG + Intronic
1187284224 X:17887355-17887377 GTATCATAATATAAGTGTCCAGG + Intergenic
1187344813 X:18453399-18453421 TTGTCCTAATAAATGTTTGCTGG - Intronic
1188221495 X:27546558-27546580 ATGTCCTGGTAGAAGTCTGCTGG - Intergenic
1192292509 X:69812641-69812663 TTGTCATGATAGAAGTCTGCAGG + Intronic
1192945924 X:75965575-75965597 GTGTCCACGAAGAAGTGTGCAGG + Intergenic
1193741878 X:85226825-85226847 GGGTGCTAAAAGGAGTGTGCTGG - Intergenic
1202101737 Y:21315901-21315923 GTCTTCTAATGGAAATGTGCTGG - Intergenic
1202187562 Y:22202869-22202891 GTCTTCTAATGGAAATGTGCTGG - Intergenic
1202188511 Y:22215689-22215711 GTCTTCTAATGGAAATGTGCTGG - Intergenic
1202203798 Y:22383527-22383549 GTCTTCTAATGGAAATGTGCTGG + Intronic