ID: 972245981

View in Genome Browser
Species Human (GRCh38)
Location 4:37245424-37245446
Sequence AGGACACCCATTCTCCACCC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 205
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 188}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972245977_972245981 11 Left 972245977 4:37245390-37245412 CCTCGCTGGCCGGTTTTGCCTGC 0: 1
1: 0
2: 0
3: 2
4: 62
Right 972245981 4:37245424-37245446 AGGACACCCATTCTCCACCCCGG 0: 1
1: 0
2: 0
3: 16
4: 188
972245976_972245981 12 Left 972245976 4:37245389-37245411 CCCTCGCTGGCCGGTTTTGCCTG 0: 1
1: 0
2: 0
3: 2
4: 69
Right 972245981 4:37245424-37245446 AGGACACCCATTCTCCACCCCGG 0: 1
1: 0
2: 0
3: 16
4: 188
972245975_972245981 13 Left 972245975 4:37245388-37245410 CCCCTCGCTGGCCGGTTTTGCCT 0: 1
1: 0
2: 0
3: 2
4: 64
Right 972245981 4:37245424-37245446 AGGACACCCATTCTCCACCCCGG 0: 1
1: 0
2: 0
3: 16
4: 188
972245980_972245981 -7 Left 972245980 4:37245408-37245430 CCTGCACACTTCTATTAGGACAC 0: 1
1: 0
2: 1
3: 10
4: 97
Right 972245981 4:37245424-37245446 AGGACACCCATTCTCCACCCCGG 0: 1
1: 0
2: 0
3: 16
4: 188
972245978_972245981 2 Left 972245978 4:37245399-37245421 CCGGTTTTGCCTGCACACTTCTA 0: 1
1: 0
2: 0
3: 11
4: 146
Right 972245981 4:37245424-37245446 AGGACACCCATTCTCCACCCCGG 0: 1
1: 0
2: 0
3: 16
4: 188

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972245981 Original CRISPR AGGACACCCATTCTCCACCC CGG Intronic
900369501 1:2325032-2325054 TGGACACCCACCCTCCTCCCCGG + Intronic
900370368 1:2329512-2329534 GGGACACCAATCCCCCACCCTGG + Intronic
900392960 1:2441699-2441721 GGGACTCCCAGACTCCACCCTGG - Intronic
901798580 1:11694162-11694184 AGGAGACCCAGCCCCCACCCAGG - Intronic
903309567 1:22443984-22444006 GGGACCCCCATTCTTCACCAAGG - Intergenic
903325774 1:22567744-22567766 AGGACACCCAGCCTCCCCACGGG + Intronic
903851432 1:26308888-26308910 AGGGCTCCCATTTTCCTCCCAGG - Intronic
904415410 1:30358525-30358547 AGAAGACCCCTCCTCCACCCAGG + Intergenic
905311390 1:37051596-37051618 GGGAGACCAATTCTCCACCCTGG + Intergenic
907496973 1:54851676-54851698 AGGACAGCTCTTCCCCACCCTGG - Exonic
910382362 1:86642074-86642096 AGGACAGCTATTCTACAACCTGG - Intergenic
915587538 1:156852281-156852303 ATGACACTCAATCTGCACCCAGG + Intronic
916215094 1:162387170-162387192 AGGACACTCATTCTTTACCTGGG + Intergenic
917470818 1:175324475-175324497 AGGACGCCCTTTCTCCACAGAGG - Exonic
920366809 1:205452260-205452282 AGGGCACACAGTCACCACCCTGG + Intronic
920866259 1:209756397-209756419 ATGCCACCCACTCTCCACCCAGG - Intronic
922478214 1:225921500-225921522 AGAACCCCCATTCTACACCCTGG + Intronic
922775147 1:228211118-228211140 AGGTCACCGGTTCTCCACCCTGG - Intronic
923486078 1:234432649-234432671 AGGGCACTCATTCTCCACGGAGG + Intronic
924767291 1:247045924-247045946 AGGTCACCCATGTTACACCCTGG + Intronic
1063316834 10:5015062-5015084 AGAGCATCCAGTCTCCACCCTGG + Intronic
1067249241 10:44573465-44573487 TGGACACCTTTTCTCCACCTTGG - Intergenic
1070064695 10:73021926-73021948 TGGACACCCCTCCTCCAGCCAGG - Intronic
1070625729 10:78049758-78049780 AGGCCACCCACTCTCCACAAAGG + Intronic
1070850871 10:79560644-79560666 AGGTCACCCACTCTGCACTCAGG + Intergenic
1071755064 10:88528353-88528375 AGGACATACATTTTCCACACAGG - Intronic
1073462971 10:103677114-103677136 AGGACAGACATTCCCCTCCCCGG + Intronic
1074165552 10:110871580-110871602 AGCTCACCCATTCTCCTCACAGG - Intergenic
1074497304 10:113991402-113991424 GGGACACACATTCACCATCCAGG - Intergenic
1074700134 10:116085512-116085534 AGGACCCCCATCCTCCTCCCCGG + Intronic
1074717024 10:116229043-116229065 AGGAGACAGATTCTCCACCAGGG + Intronic
1075136269 10:119788831-119788853 AGCACACCTAGTCTGCACCCAGG - Intronic
1077488334 11:2849341-2849363 AGGACCCACATGCTCCACTCTGG + Intergenic
1079370190 11:19846045-19846067 TGGAGACCCATTCTACCCCCAGG + Intronic
1079991038 11:27247413-27247435 AGGAAACTCATTCTCCCTCCAGG + Intergenic
1080469107 11:32527980-32528002 AGCACACACATGGTCCACCCTGG + Intergenic
1083436638 11:62647614-62647636 GGGACACACACTCTCCACCAAGG + Exonic
1084518117 11:69647241-69647263 AGTACACCCCAACTCCACCCGGG - Intronic
1084652332 11:70496508-70496530 AGGACACCTTTCCTTCACCCTGG - Intronic
1088074540 11:105830744-105830766 AAGAGACCTATTCTCCACCCAGG + Intronic
1089492403 11:118892246-118892268 AGCAGACCCATTCTCCAACCTGG - Intronic
1090274563 11:125410364-125410386 GGGCCACCCTTTCTCCTCCCAGG - Intronic
1091036241 11:132236784-132236806 AGGCCAGCCATTCTCCATGCCGG - Intronic
1091217006 11:133908257-133908279 TGGCCACCCCTTCTTCACCCAGG + Intergenic
1092124818 12:6067675-6067697 CGCTCACCCATCCTCCACCCAGG + Intronic
1096436039 12:51591594-51591616 AGGACCACCAGTCCCCACCCCGG + Intronic
1097048642 12:56206684-56206706 AGGACAGCCACTCTCCACCAGGG + Exonic
1102461346 12:113101739-113101761 TAGACACCCAGTCCCCACCCTGG + Intronic
1102512912 12:113427932-113427954 AGGACACAAAGTCACCACCCAGG - Intronic
1102745477 12:115245236-115245258 GGGATTCCCATTATCCACCCTGG - Intergenic
1103929253 12:124440432-124440454 AGGACCCCCATGGCCCACCCTGG - Intronic
1104242951 12:127008711-127008733 ACCACCCCCTTTCTCCACCCCGG + Intergenic
1105241675 13:18614544-18614566 GGGGCATCCTTTCTCCACCCAGG + Intergenic
1110071562 13:71184697-71184719 TGGACACCCCTCCTCCAGCCAGG - Intergenic
1113335419 13:109372239-109372261 AGGACCCCCAGTCTCCAGTCTGG + Intergenic
1114587405 14:23826992-23827014 AGGGCGTCCTTTCTCCACCCAGG - Intergenic
1117956340 14:61126314-61126336 AGAACCCCCATCCTTCACCCCGG - Intergenic
1121117832 14:91356043-91356065 AGCACACACATGCCCCACCCCGG + Intronic
1122026511 14:98881453-98881475 ATGACACCCATGATCCACCTGGG + Intergenic
1122271670 14:100571047-100571069 AGGGCACCCAGTGTGCACCCTGG - Intronic
1122323673 14:100870061-100870083 AGGACACCCATCATTCACCTGGG + Intergenic
1122323858 14:100871103-100871125 AGGACACCCATCATTCACCTGGG + Intergenic
1122412389 14:101532360-101532382 AGGAGAGGCAGTCTCCACCCAGG + Intergenic
1122866719 14:104609067-104609089 CAGCCACCCTTTCTCCACCCAGG + Intergenic
1123192470 14:106584597-106584619 AGGAAACCCGTTCTCCAGCTTGG + Intergenic
1123479339 15:20616528-20616550 TGGACATCCATTCTCCCTCCAGG + Intergenic
1123638674 15:22383857-22383879 TGGACATCCATTCTCCCTCCAGG - Intergenic
1124369584 15:29096271-29096293 AGGACACCCATCATCCTCCTTGG - Intronic
1124662476 15:31561507-31561529 GGGGCACCCATGCTCCTCCCGGG + Intronic
1127044784 15:55014033-55014055 ATGCCAGCCATGCTCCACCCTGG + Intergenic
1127692123 15:61407378-61407400 AGGACACCCCTACACCAGCCTGG + Intergenic
1128578472 15:68792088-68792110 AGAACATCCCTTTTCCACCCAGG + Intronic
1129657166 15:77531906-77531928 AGGAGCTCCGTTCTCCACCCAGG - Intergenic
1135352381 16:21739888-21739910 ATCACACCTATTCTCCAGCCTGG - Intronic
1135450869 16:22556010-22556032 ATCACACCTATTCTCCAGCCTGG - Intergenic
1136653854 16:31697093-31697115 AAGACTCCCTTTCTCCACCAGGG - Intergenic
1138461642 16:57151893-57151915 ATCACACTCATTTTCCACCCAGG + Intergenic
1140020928 16:71237898-71237920 ATGACACCCATCCTCCACATAGG - Intergenic
1140218988 16:73030054-73030076 CAAACACCCATTCTCCTCCCAGG + Intronic
1141649511 16:85385557-85385579 CGGACACCCCTCCTCCACCAGGG - Intergenic
1141774778 16:86115994-86116016 AGGCCACCCCCTCCCCACCCTGG + Intergenic
1143733988 17:8897513-8897535 ATAACACCCTTTCACCACCCTGG + Intronic
1144954801 17:19013637-19013659 AGGACACCCAGGCTCCAAGCAGG - Intronic
1145178303 17:20721345-20721367 AGGACACACCCTCTCCATCCTGG + Intergenic
1146643791 17:34562977-34562999 AAGACACCTATCCTCCACCCTGG + Intergenic
1147336297 17:39728565-39728587 ACAACACCCATTCTCCCCCTGGG - Exonic
1147572728 17:41581275-41581297 AGGAAAGGCATTCCCCACCCAGG + Intergenic
1147970166 17:44215065-44215087 AGGACACACATTGTCCCTCCTGG - Intronic
1149837946 17:59930930-59930952 AGGACACACCCTCTCCATCCTGG + Intronic
1150081342 17:62242304-62242326 AGGACACACCCTCTCCATCCTGG - Intergenic
1151424665 17:74023199-74023221 AGGAGAACCAACCTCCACCCTGG - Intergenic
1152234753 17:79132874-79132896 AGGAACCCTCTTCTCCACCCTGG + Intronic
1152634113 17:81423459-81423481 AGGACAGCCATTCCCCTGCCCGG - Intronic
1154296726 18:13157807-13157829 AGGACAACCATCCTCAGCCCTGG - Intergenic
1154314084 18:13290141-13290163 GGGGCACCCATTCTTCCCCCTGG + Intronic
1156317774 18:35986829-35986851 AAGAACCCCATTCTCCACCTGGG - Intronic
1158701612 18:59753796-59753818 AGGGCTCCCTTTCACCACCCAGG - Intergenic
1160143789 18:76348120-76348142 AAGGCACCCACTCTCCAGCCTGG + Intergenic
1160193895 18:76737361-76737383 ATGACACCCATCCTCCACTTAGG - Intergenic
1160818458 19:1047044-1047066 AGCGCACCCATTCTGCAGCCGGG - Intronic
1160846482 19:1168354-1168376 CCGACAGCCATTCTCCACCAGGG + Intronic
1162489578 19:10984307-10984329 AGGACACCCCATCCCCACCCAGG + Exonic
1163562759 19:18030167-18030189 AGGGGACTCATTCCCCACCCTGG - Intergenic
1164917318 19:32062322-32062344 AGGACAATGATTCTCAACCCTGG + Intergenic
1165330580 19:35139439-35139461 AGGTCACCCCGTCTCCTCCCTGG - Intronic
926135222 2:10331444-10331466 AGGACACCGTTTCTGAACCCAGG + Intronic
928161893 2:28935002-28935024 TGGAGACCCAGTCTCCACACTGG - Intronic
928954713 2:36852320-36852342 AGGACACCCCTTCCTCTCCCTGG - Intronic
929318841 2:40515123-40515145 AGGACACTCATTCCCAACTCTGG + Intronic
931542079 2:63340422-63340444 AGGACTACTATCCTCCACCCTGG - Intronic
932329854 2:70892051-70892073 AGGACAGCAATTCTCCTCCCAGG - Intergenic
935349149 2:102139102-102139124 AGGACAACCATTCTTCAGCTCGG - Intronic
938556671 2:132430758-132430780 AGGAGACCCATGTTCTACCCAGG + Intronic
940352034 2:152701713-152701735 AGGATTCCCATTCTCCTCCGGGG + Intronic
940658898 2:156522104-156522126 AGGACACACTGTGTCCACCCAGG + Intronic
942475135 2:176311610-176311632 AGGACACCCCTCCTCCAGCCAGG + Intronic
943344442 2:186721301-186721323 AGAACAGCAATTCTCAACCCTGG - Intronic
948495452 2:238345792-238345814 AGGTGACCCAGTCCCCACCCAGG - Intronic
1170632314 20:18075946-18075968 AGGACCCCCATTCCCCTCCTTGG - Intergenic
1171191709 20:23163689-23163711 AGGAAACCCCTTCTGCAGCCTGG + Intergenic
1171495697 20:25553676-25553698 AGGACACTCTTTTTCGACCCAGG - Intronic
1174168549 20:48601879-48601901 GGGACATCCATTCTTCAGCCTGG + Intergenic
1174462102 20:50690414-50690436 AGGGCAGCCAGCCTCCACCCTGG + Intronic
1175471880 20:59236034-59236056 AGGATACCAATTTTTCACCCTGG + Intronic
1179189342 21:39109408-39109430 AGGACACACACTGTCCACCCTGG - Intergenic
1181463529 22:23098841-23098863 AGGACAGCCCGTCTCCAGCCGGG + Intronic
1181674242 22:24441465-24441487 AGGACACTCCTGCTCCATCCTGG - Exonic
1183408210 22:37640537-37640559 TGGACACCCAGTCCCCTCCCTGG - Intronic
1183437155 22:37802774-37802796 TGGACACCCCTTCTCCCGCCAGG - Intergenic
1184065291 22:42115384-42115406 AGGATTCCCATTCTCCTCCAGGG - Intergenic
1185374125 22:50474506-50474528 CGGACGCCCATTCTCCCCACGGG + Intronic
951439507 3:22707093-22707115 CGGACGCCCCTTCTCCAGCCAGG + Intergenic
951907553 3:27720198-27720220 AGGTCACCCATTTGCCCCCCTGG + Exonic
951908045 3:27722578-27722600 AGGACCCCCACCCTCCTCCCAGG + Intronic
954906876 3:54070623-54070645 AGGAGTCCCATTCTCCTCCGGGG + Intergenic
955770715 3:62382123-62382145 AGGAGACCCAAGTTCCACCCAGG - Intergenic
957110802 3:75954406-75954428 AGGAGACCCATTCACCGCACAGG - Intronic
959748874 3:109809796-109809818 AGGAGACCCATCCTCAATCCTGG - Intergenic
969370178 4:6727047-6727069 AGGCCACCCATCTGCCACCCGGG - Intergenic
969496827 4:7530997-7531019 GGGAGCCCCATCCTCCACCCTGG - Intronic
971524721 4:27602481-27602503 AGTACATCCATTCTACACACAGG + Intergenic
972245981 4:37245424-37245446 AGGACACCCATTCTCCACCCCGG + Intronic
979058399 4:116023118-116023140 ATTACTCCCATTCTCAACCCTGG - Intergenic
979218338 4:118193038-118193060 AGGAGTCTCCTTCTCCACCCTGG + Intronic
984356948 4:178672855-178672877 GGGACACGAACTCTCCACCCTGG - Intergenic
985988799 5:3538576-3538598 AGGACAGACACTCCCCACCCAGG + Intergenic
988625064 5:32866090-32866112 AGGTCACCCAGTTTCCCCCCAGG - Intergenic
989204251 5:38795975-38795997 AGGAAGTACATTCTCCACCCAGG + Intergenic
989447100 5:41542496-41542518 AGGACACCCATTTTCAATCTGGG - Intergenic
991141045 5:63243586-63243608 AGGACTCCCATTCTCAGCCTTGG + Intergenic
996796824 5:127356685-127356707 TGGAAACCTATTCTCCTCCCTGG - Intronic
999801724 5:155044728-155044750 TGGACCCCCACTCTCCACCAAGG + Intergenic
1000260645 5:159585218-159585240 AGGACACCCATCTTCTAGCCTGG - Intergenic
1000993143 5:167931616-167931638 AAGAAGCTCATTCTCCACCCGGG - Intronic
1001116771 5:168946793-168946815 AAGACACCCTTTCTAAACCCTGG - Intronic
1001757157 5:174179418-174179440 AGGCCACCCATTTTCCAAACTGG - Intronic
1002069610 5:176671572-176671594 ATGAGACCCACCCTCCACCCTGG - Intergenic
1002084850 5:176768062-176768084 AGGAAACTCATTCTACAGCCTGG + Intergenic
1002711983 5:181200833-181200855 AGGACTCCCTTCCTCCGCCCAGG - Intronic
1003292349 6:4789981-4790003 AGAAAACCCATTCTCCAGCAAGG - Intronic
1006253244 6:32808089-32808111 AGGAGACCCATTGACCACCATGG - Intergenic
1007752709 6:44080117-44080139 AGAGGACCCATTCTCAACCCTGG - Intergenic
1008587785 6:52964910-52964932 AGGACCCCCACTCCCCAACCCGG + Intergenic
1013166954 6:107603282-107603304 CTGACACCCATTCTCCATTCAGG - Intronic
1016846683 6:148574988-148575010 ATGACTCCCTTGCTCCACCCTGG + Intergenic
1017906507 6:158760502-158760524 CGGACACACCTGCTCCACCCAGG + Intronic
1018994739 6:168702179-168702201 AGAATACCCATTCTATACCCAGG - Intergenic
1023758403 7:43441263-43441285 GGGACCCCAAGTCTCCACCCTGG - Intronic
1024178156 7:46861858-46861880 AGGACATCCTTTCCCCACCCAGG - Intergenic
1024855432 7:53773016-53773038 AGGAGAGCCATCCTTCACCCTGG + Intergenic
1028875733 7:95821442-95821464 AAGACAGGCATTCTCCAACCAGG - Intronic
1030807759 7:113937522-113937544 AGGACACCCCTTGACCACCATGG - Intronic
1031818740 7:126472753-126472775 AGGAAACCATTTTTCCACCCAGG - Intronic
1032549767 7:132773314-132773336 AATACACCCATTCACCACTCAGG + Intergenic
1035443464 7:158923025-158923047 AGGCCTCCCATTCACCGCCCAGG + Intronic
1036103191 8:5810443-5810465 AAGACAGCCATTCACCACCATGG + Intergenic
1036120175 8:6008294-6008316 AAGACAGCCATTCTCAACTCAGG + Intergenic
1038040452 8:23719916-23719938 AGGACACCCATTGCCCTCTCTGG - Intergenic
1038366622 8:26942257-26942279 AGGACAGCCATTTGCAACCCAGG - Intergenic
1038751957 8:30304078-30304100 AGGAGCCCCACTCCCCACCCTGG - Intergenic
1039156903 8:34570415-34570437 TGGACATCCATTCCCCAACCTGG - Intergenic
1045005284 8:97912035-97912057 ACCACACTCATTCTCCACCCTGG - Intronic
1046662175 8:116959786-116959808 AGGAAACCCAGTCTTCACACAGG - Intronic
1047223886 8:122940468-122940490 AGGACACCCAGCCTCCTCTCAGG + Intronic
1048499548 8:134963236-134963258 AGGACACCCCTTCCCCTCCTAGG - Intergenic
1049290693 8:141800098-141800120 AGGTGACCCATTGTCCACTCCGG - Intergenic
1049521244 8:143092510-143092532 TGAGCACACATTCTCCACCCTGG - Intergenic
1050425738 9:5510865-5510887 AGGCCACCCTTCCCCCACCCTGG - Intronic
1051785000 9:20732568-20732590 AGTACATTCCTTCTCCACCCAGG - Intronic
1052242014 9:26284407-26284429 AGAACATCGATTCTCCCCCCTGG + Intergenic
1055310470 9:74974205-74974227 AGGAAACTCAGTCACCACCCTGG - Intergenic
1055363418 9:75519435-75519457 AGGACACACAGACTCCACGCGGG + Intergenic
1056257122 9:84811568-84811590 AGGCCAGCCATTCTGCTCCCAGG - Intronic
1056752908 9:89364729-89364751 AGGCCAGCCAGGCTCCACCCTGG - Intronic
1058711326 9:107681928-107681950 AGAACACCCTTCCTCCTCCCGGG + Intergenic
1058950674 9:109901078-109901100 AGGACCCCCATTTTCCAGTCTGG - Intronic
1059386614 9:113969599-113969621 AGGCCGCCCCCTCTCCACCCTGG - Intronic
1062182574 9:135198502-135198524 AGGAGACACCGTCTCCACCCTGG - Intergenic
1062490805 9:136804001-136804023 TGGCCACCCCTTCTCCACCCCGG - Intronic
1185615584 X:1419735-1419757 AGGACAGCCGGTCTCCATCCTGG + Intronic
1187411016 X:19050545-19050567 AGCTCACCGATTCTCAACCCTGG + Intronic
1188743886 X:33817756-33817778 AGGAGACCCATCGTCCACCATGG - Intergenic
1193580696 X:83259665-83259687 AGGACACCCTTTTACCACCATGG + Intergenic
1195903558 X:109822764-109822786 AGGACAGCCATTTTCCAGCAAGG - Intergenic
1198957194 X:142146336-142146358 AGGACACCCACCCTCAATCCAGG + Intergenic