ID: 972245982

View in Genome Browser
Species Human (GRCh38)
Location 4:37245425-37245447
Sequence GGACACCCATTCTCCACCCC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 217
Summary {0: 1, 1: 0, 2: 4, 3: 16, 4: 196}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972245975_972245982 14 Left 972245975 4:37245388-37245410 CCCCTCGCTGGCCGGTTTTGCCT 0: 1
1: 0
2: 0
3: 2
4: 64
Right 972245982 4:37245425-37245447 GGACACCCATTCTCCACCCCGGG 0: 1
1: 0
2: 4
3: 16
4: 196
972245980_972245982 -6 Left 972245980 4:37245408-37245430 CCTGCACACTTCTATTAGGACAC 0: 1
1: 0
2: 1
3: 10
4: 97
Right 972245982 4:37245425-37245447 GGACACCCATTCTCCACCCCGGG 0: 1
1: 0
2: 4
3: 16
4: 196
972245976_972245982 13 Left 972245976 4:37245389-37245411 CCCTCGCTGGCCGGTTTTGCCTG 0: 1
1: 0
2: 0
3: 2
4: 69
Right 972245982 4:37245425-37245447 GGACACCCATTCTCCACCCCGGG 0: 1
1: 0
2: 4
3: 16
4: 196
972245978_972245982 3 Left 972245978 4:37245399-37245421 CCGGTTTTGCCTGCACACTTCTA 0: 1
1: 0
2: 0
3: 11
4: 146
Right 972245982 4:37245425-37245447 GGACACCCATTCTCCACCCCGGG 0: 1
1: 0
2: 4
3: 16
4: 196
972245977_972245982 12 Left 972245977 4:37245390-37245412 CCTCGCTGGCCGGTTTTGCCTGC 0: 1
1: 0
2: 0
3: 2
4: 62
Right 972245982 4:37245425-37245447 GGACACCCATTCTCCACCCCGGG 0: 1
1: 0
2: 4
3: 16
4: 196

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972245982 Original CRISPR GGACACCCATTCTCCACCCC GGG Intronic
900116939 1:1033040-1033062 AGACCCCCATTCCCCGCCCCGGG + Intronic
900369502 1:2325033-2325055 GGACACCCACCCTCCTCCCCGGG + Intronic
900370369 1:2329513-2329535 GGACACCAATCCCCCACCCTGGG + Intronic
900391441 1:2435677-2435699 GGAAACCCAGTCTCCCCTCCTGG - Intronic
901686574 1:10946793-10946815 GGCATCCCATTCTCCTCCCCTGG + Intronic
903309566 1:22443983-22444005 GGACCCCCATTCTTCACCAAGGG - Intergenic
903915811 1:26763372-26763394 ACACACCCATTTTCCCCCCCTGG - Intronic
904333390 1:29781403-29781425 GGACACCCACTCTCTTCCACTGG - Intergenic
904786211 1:32984969-32984991 GGCCACCCAGACTCCATCCCAGG + Intergenic
904830387 1:33302667-33302689 GGACAGCCATTATGCACCACTGG - Intergenic
905311391 1:37051597-37051619 GGAGACCAATTCTCCACCCTGGG + Intergenic
905415422 1:37800528-37800550 GGCCACCCAGTCACCACCCTTGG + Exonic
906536965 1:46556401-46556423 GGTCAGGCACTCTCCACCCCTGG - Intergenic
907372842 1:54014235-54014257 GGACTCCCATCATGCACCCCAGG - Exonic
909932586 1:81514463-81514485 GGATAGCCATTTTGCACCCCTGG - Intronic
910368041 1:86487463-86487485 CCACACCCAGACTCCACCCCAGG - Intronic
910987282 1:93017630-93017652 GAACCCCCATTTTCAACCCCTGG - Intergenic
911411245 1:97510236-97510258 GGACCCTGATTCTCCATCCCTGG + Intronic
911634001 1:100213435-100213457 GGACACCCACCCACCATCCCAGG + Intronic
912853501 1:113147227-113147249 GTACACCCATTCACCAGCCCAGG - Intergenic
915393029 1:155561957-155561979 GGACACCCCTTCACCCCGCCTGG + Intronic
915409185 1:155687875-155687897 GGACACCCCTTCACCCCGCCTGG + Intronic
917006989 1:170426376-170426398 GGACATCCCTTCTCCAGCCAAGG + Intergenic
917213833 1:172657803-172657825 GGTCACCCAGCCTCCACCACTGG - Intergenic
920866258 1:209756396-209756418 TGCCACCCACTCTCCACCCAGGG - Intronic
923306822 1:232696186-232696208 GGACACACCTTCTCCCCACCTGG - Intergenic
1065751358 10:28890684-28890706 GGAAACACATTCCCCACCTCAGG - Intergenic
1066330960 10:34422087-34422109 GGACACCCACTCTCACCCCTAGG + Intronic
1067102420 10:43342883-43342905 GGCCCCCCACCCTCCACCCCAGG + Intergenic
1067249240 10:44573464-44573486 GGACACCTTTTCTCCACCTTGGG - Intergenic
1067735825 10:48849561-48849583 AGACTCCCATTCTCCATCCCAGG + Intronic
1067742753 10:48908253-48908275 GCACACCTGTTCCCCACCCCTGG - Intronic
1070946441 10:80395750-80395772 TGACGCCTATTCTCCACCCTTGG - Intergenic
1072927614 10:99630152-99630174 GGAGTCCCATTCTATACCCCTGG + Intergenic
1076649213 10:131976298-131976320 GGACACCAAGTCACCACCACCGG + Intronic
1077142595 11:1031056-1031078 TGACCCCCATTCTGCACCCCAGG - Exonic
1077167875 11:1151982-1152004 AGACCCCCACCCTCCACCCCAGG + Intergenic
1077360204 11:2137483-2137505 GGGCTCCCATCCTGCACCCCCGG + Intronic
1079343836 11:19634621-19634643 GGACACATATTCTGGACCCCAGG + Intronic
1079370191 11:19846046-19846068 GGAGACCCATTCTACCCCCAGGG + Intronic
1080683154 11:34494612-34494634 GAACACCAAATCTCTACCCCTGG - Intronic
1081632687 11:44700585-44700607 AGACCCCCAATCTCTACCCCTGG - Intergenic
1081702412 11:45160131-45160153 GAACACCCATTCTGAACCTCGGG - Intronic
1083505963 11:63157402-63157424 TGCCACCCATCCTCCACCCCAGG - Intronic
1084412431 11:69012589-69012611 GGACACCCCATGTGCACCCCAGG + Intronic
1085084879 11:73660514-73660536 TGACACCCATTCTCCAACTCTGG - Intronic
1085341039 11:75731824-75731846 GCACAAGCACTCTCCACCCCAGG + Intronic
1086469697 11:87095018-87095040 GGAAACCCATTGAACACCCCCGG - Intronic
1089119735 11:116125100-116125122 TGACAGCCAGGCTCCACCCCTGG + Intergenic
1089492402 11:118892245-118892267 GCAGACCCATTCTCCAACCTGGG - Intronic
1090274562 11:125410363-125410385 GGCCACCCTTTCTCCTCCCAGGG - Intronic
1090609052 11:128453826-128453848 GGACATGCATTCCCCACCACTGG + Intergenic
1091036240 11:132236783-132236805 GGCCAGCCATTCTCCATGCCGGG - Intronic
1091688886 12:2582670-2582692 GGCCCCCAATTCTCCTCCCCAGG - Intronic
1091728757 12:2864536-2864558 GTACACCCCTTCTCAGCCCCAGG + Intronic
1093528873 12:20136697-20136719 GGACACCCATGCTTCTCCCATGG - Intergenic
1096513102 12:52142696-52142718 GAGCACCCATCCTCCACCCATGG - Intergenic
1102461347 12:113101740-113101762 AGACACCCAGTCCCCACCCTGGG + Intronic
1104242953 12:127008712-127008734 CCACCCCCTTTCTCCACCCCGGG + Intergenic
1104655897 12:130573818-130573840 GGACAGCCATGCTCCAGGCCTGG - Intronic
1104981195 12:132573778-132573800 GCACACCTAGTCTCCAGCCCAGG - Intronic
1106123463 13:26881263-26881285 GGAGAGCCATTCTCCACCCCCGG + Intergenic
1106509360 13:30399491-30399513 GCAAGCCCATTCTCCAGCCCAGG - Intergenic
1110791379 13:79590392-79590414 GGACACTCAGCCTCCTCCCCTGG - Intergenic
1110907783 13:80914832-80914854 GGACATCCATTCTCAACTTCAGG + Intergenic
1119390547 14:74288586-74288608 ATACTCCCATTCTCCACCCCAGG + Intronic
1119440862 14:74627955-74627977 GAAGACCTCTTCTCCACCCCTGG + Intergenic
1119548865 14:75493560-75493582 GGAAACCCCTTCTCCAGCTCAGG - Intergenic
1121117833 14:91356044-91356066 GCACACACATGCCCCACCCCGGG + Intronic
1122822798 14:104355525-104355547 GGACAGCCACTCACCACCCTTGG - Intergenic
1122977309 14:105176142-105176164 AGCCACCCCTTCTCCAGCCCAGG + Intronic
1130949138 15:88571742-88571764 GGACACTCATTCTCCCCAGCAGG - Intergenic
1130980716 15:88810276-88810298 GGTTACCCATTGTCCACCCTTGG + Intronic
1132674957 16:1117684-1117706 GGACCCCCACTCCCCACCGCAGG + Intergenic
1140117086 16:72051271-72051293 GGAGCCCATTTCTCCACCCCTGG - Intronic
1140218989 16:73030055-73030077 AAACACCCATTCTCCTCCCAGGG + Intronic
1140655208 16:77132553-77132575 TGACACTCATTCTCCATCTCAGG + Intergenic
1142400169 16:89854457-89854479 TGAGACCCATTCTCTTCCCCTGG + Intronic
1144808190 17:17981399-17981421 GGATACCCAACCACCACCCCAGG - Intronic
1145939563 17:28735494-28735516 GGACACCCATAGCCCTCCCCTGG - Intronic
1146634526 17:34494304-34494326 GAATGCCTATTCTCCACCCCAGG + Intergenic
1147985927 17:44308032-44308054 GGATTCCCATCCTCCACCCCAGG + Intergenic
1148090109 17:45018417-45018439 GCTCTCTCATTCTCCACCCCTGG + Intergenic
1150294158 17:63998879-63998901 GCCAACCCATTCTTCACCCCCGG + Intronic
1150339974 17:64358501-64358523 GCCCACCCATTCTCAAGCCCTGG + Intronic
1151455416 17:74222824-74222846 GGAGACCCCATCACCACCCCAGG - Intronic
1152024578 17:77800504-77800526 AGCCACCCATCCTCTACCCCAGG + Intergenic
1152634112 17:81423458-81423480 GGACAGCCATTCCCCTGCCCGGG - Intronic
1153009360 18:523871-523893 GGTTACACAATCTCCACCCCTGG - Intergenic
1155652456 18:28158419-28158441 GGACAAGCATTGTCCACCCATGG + Intronic
1156489803 18:37489400-37489422 GGCCCCCCATTCTCCACCACAGG - Intronic
1157399144 18:47372381-47372403 TGACCCCCAAACTCCACCCCAGG - Intergenic
1158313877 18:56189225-56189247 GGACTCCTTTTCTCCACTCCAGG - Intergenic
1160685060 19:430805-430827 GGACCCCCAGTCTCCCCGCCCGG + Intronic
1160841841 19:1149860-1149882 CGACACCCACCCTCCACCACAGG - Intronic
1161712226 19:5855320-5855342 GGACACCCCTACTCCCTCCCCGG + Intergenic
1161821010 19:6531392-6531414 GGACACCTGTTCTACACTCCCGG + Intronic
1162480377 19:10923913-10923935 GGACACCCTTGCGCCACCGCAGG + Exonic
1162489579 19:10984308-10984330 GGACACCCCATCCCCACCCAGGG + Exonic
1163647644 19:18499038-18499060 GGCCACTCATTCTCAAGCCCAGG + Intronic
1166197954 19:41219165-41219187 GGCAACCCTTTCTCCGCCCCTGG - Intergenic
1167105796 19:47429458-47429480 GGACACTCATTCTCCAGGCTCGG - Exonic
1168074071 19:53969644-53969666 GGACCCCGTTTCTACACCCCTGG - Intronic
925018808 2:552796-552818 GCTCTCCCATTTTCCACCCCTGG + Intergenic
925321263 2:2971037-2971059 GGAAACTATTTCTCCACCCCTGG - Intergenic
925705360 2:6679691-6679713 GGATCCCCATTCTCCAGCACAGG - Intergenic
928161892 2:28935001-28935023 GGAGACCCAGTCTCCACACTGGG - Intronic
931711530 2:64992174-64992196 GAACATCCATTCTCCCTCCCTGG - Intronic
931712130 2:64997464-64997486 CAATCCCCATTCTCCACCCCTGG + Intronic
932597161 2:73101180-73101202 GCACCCTGATTCTCCACCCCTGG - Intronic
934046748 2:88178949-88178971 GGACACACATCCCCTACCCCTGG + Exonic
937493971 2:122398719-122398741 GGACATCCATTTTCTACCCTCGG + Intergenic
937590071 2:123602196-123602218 GGACAAACATTCTCCACTACAGG + Intergenic
938376201 2:130808323-130808345 GGAGGCCCATCCTCCTCCCCAGG - Intergenic
942475136 2:176311611-176311633 GGACACCCCTCCTCCAGCCAGGG + Intronic
942944879 2:181661247-181661269 GGAAACACAGTCTCCATCCCTGG + Intronic
943486994 2:188497673-188497695 GGACACACATTTTCTACACCTGG - Intronic
943670742 2:190657716-190657738 GGACACCCATTCTCCTGGCTTGG + Intronic
945037301 2:205715224-205715246 AGACACACATTTTCCAGCCCCGG - Intronic
947624924 2:231613373-231613395 TGACATCCCTTCCCCACCCCAGG + Intergenic
948194611 2:236085859-236085881 GGACAGCCATTGTCCCCTCCAGG - Intronic
948423718 2:237875477-237875499 GGTCACCCACCCTCGACCCCTGG - Intronic
948654304 2:239466977-239466999 GGACCCACCTTGTCCACCCCAGG - Intergenic
948751266 2:240134739-240134761 GGACACTCAGTCTCCTCCCCTGG + Intronic
948804331 2:240446970-240446992 GGACACCCCTTATCCCCCCATGG - Intronic
1168879927 20:1197752-1197774 GGCCAGCCATTCTTCACCCATGG - Intergenic
1168989062 20:2078846-2078868 GGACACCCTTCCTCCTGCCCTGG - Intergenic
1171351206 20:24504586-24504608 GAACATCCATGCTCCACCACAGG - Intronic
1172782287 20:37443974-37443996 GGAGACTCCGTCTCCACCCCAGG - Intergenic
1172970059 20:38866637-38866659 GGAGACCCACCCTCCATCCCAGG - Intronic
1175543461 20:59762731-59762753 GGAAACCCATTCTCCAAACCAGG - Intronic
1176086306 20:63297032-63297054 GGACACCCATCCCCCATCGCGGG + Intronic
1181013394 22:20055025-20055047 GGACCCACCTTCCCCACCCCTGG - Intronic
1181638288 22:24184348-24184370 GGACCCCCTTTCTCCCCCTCTGG - Intronic
1181916376 22:26284149-26284171 GGACAGCCATTCCCCTCCTCTGG - Intronic
1182097766 22:27637554-27637576 TGACAGCGAGTCTCCACCCCAGG - Intergenic
1182557004 22:31134537-31134559 GGACCCCAGTTGTCCACCCCTGG - Exonic
1182886285 22:33776920-33776942 GCATCCCCATTCTCCAGCCCTGG - Intronic
1183028422 22:35083918-35083940 GGCCACCCCTTTTCAACCCCTGG - Intronic
1183469882 22:37999578-37999600 TGACACCCCTTCCCCTCCCCAGG + Intronic
1183583201 22:38737728-38737750 AGATTCCCAGTCTCCACCCCAGG - Intronic
1184504287 22:44891605-44891627 GGACACCCTCTCTGCACCCATGG + Intronic
1184653899 22:45931741-45931763 GGACACCCATCCCCCTCCACAGG - Intronic
1184711736 22:46254561-46254583 GGGAAACCCTTCTCCACCCCTGG + Intergenic
1184924981 22:47630448-47630470 AGACACCCCTTCCCCACCCATGG - Intergenic
1185111085 22:48900629-48900651 GGGCACCCATGCTACACACCAGG + Intergenic
1185333761 22:50262592-50262614 TGACACCCCTTCACCAGCCCAGG + Intergenic
950468032 3:13166990-13167012 GCACAGGCATCCTCCACCCCGGG - Intergenic
951171119 3:19543096-19543118 GGGTACCCTTTCTCCACCACAGG - Intergenic
956622375 3:71234328-71234350 GCACACTCATCCTCCACCACTGG + Intronic
956669226 3:71670976-71670998 GGAAACCCATTCTCCGCGCTTGG - Intergenic
959957027 3:112251326-112251348 GGGCACCCATTCTTCTCCCATGG + Intronic
963963960 3:151344358-151344380 GCACACCCATTCTTCCTCCCAGG + Intronic
972245982 4:37245425-37245447 GGACACCCATTCTCCACCCCGGG + Intronic
979695122 4:123604315-123604337 GAACACCCATTCTGCTGCCCAGG + Intergenic
982781224 4:159493172-159493194 GGAGACCCACTTCCCACCCCTGG + Intergenic
983944286 4:173568558-173568580 GGACACCCATCTTTCACCACAGG + Intergenic
985166490 4:187100505-187100527 GCATCCCCATTCTCCAGCCCAGG + Intergenic
985509952 5:307875-307897 GGAGACCCAGTGTCCACCCCCGG - Intronic
990244868 5:53854405-53854427 GGACACCCCTCCCCCAGCCCAGG + Intergenic
997470754 5:134115512-134115534 CGCCCCCCACTCTCCACCCCTGG - Intronic
998548552 5:143053282-143053304 TGAATCTCATTCTCCACCCCTGG + Intronic
998775178 5:145591730-145591752 GGAAACCCATTCTTTACCACAGG + Intronic
999134076 5:149306209-149306231 TGACACCCCTGCTCCACCTCAGG - Intronic
999309023 5:150539480-150539502 GGAGACCCACTCTCCAGCACTGG + Intronic
999801725 5:155044729-155044751 GGACCCCCACTCTCCACCAAGGG + Intergenic
1003072937 6:2958960-2958982 GGGCGCCCCCTCTCCACCCCAGG + Intronic
1005314413 6:24590530-24590552 GGACACCTATTCTGCAGCCCTGG - Intronic
1005881694 6:30067246-30067268 GGCCTCCGCTTCTCCACCCCTGG - Exonic
1007335855 6:41154412-41154434 GAACTCCCTTTCCCCACCCCTGG - Intergenic
1013166953 6:107603281-107603303 TGACACCCATTCTCCATTCAGGG - Intronic
1015243997 6:131057333-131057355 AGAACCCCACTCTCCACCCCAGG + Intronic
1017132420 6:151118989-151119011 GGTCTTCCACTCTCCACCCCTGG - Intergenic
1017188048 6:151622512-151622534 AGACACCAATTCTGAACCCCTGG - Intergenic
1017906508 6:158760503-158760525 GGACACACCTGCTCCACCCAGGG + Intronic
1018334894 6:162776562-162776584 GGCCGCCCATTCTCCTGCCCTGG + Intronic
1020335260 7:7057855-7057877 GTACACCTTCTCTCCACCCCCGG - Intergenic
1021934691 7:25618372-25618394 TTACACCCATTCTGGACCCCAGG + Intergenic
1022624015 7:32015351-32015373 AGACACTAATTCTCCACCCCAGG + Intronic
1023863864 7:44229623-44229645 GGCCACCCCACCTCCACCCCAGG - Intronic
1026913797 7:74107791-74107813 GGAAGCCCCATCTCCACCCCAGG - Intronic
1032401817 7:131629273-131629295 GTGCACCCACCCTCCACCCCAGG - Intergenic
1033609522 7:142952580-142952602 GGTGACCCTTTCTCCAGCCCTGG - Exonic
1035426530 7:158779877-158779899 GGACTGCCCCTCTCCACCCCAGG - Intronic
1036916638 8:12810687-12810709 GGATACTCATTCCCCAGCCCAGG - Intergenic
1037891760 8:22627418-22627440 GCACATCCACTGTCCACCCCGGG - Intronic
1040599950 8:48872918-48872940 GGACACACCTTCTGCACCCTCGG + Intergenic
1041467426 8:58170776-58170798 GGGCACACATTCTCCTCCCTTGG - Intronic
1042200834 8:66278330-66278352 GGATACTCTTTCTCTACCCCTGG - Intergenic
1043921374 8:85987481-85987503 GGAGACCCACTCTCAAACCCTGG + Intronic
1044449169 8:92313873-92313895 GGACACCCCTTCCCCACCCCAGG + Intergenic
1045005282 8:97912034-97912056 CCACACTCATTCTCCACCCTGGG - Intronic
1047440017 8:124869597-124869619 GAACACCCATTCTCCTTCCCTGG + Intergenic
1047486344 8:125334458-125334480 GGACACCCATTCTGCGCCCCTGG + Intronic
1048447516 8:134502984-134503006 TGACACCCCATCCCCACCCCAGG + Intronic
1049290692 8:141800097-141800119 GGTGACCCATTGTCCACTCCGGG - Intergenic
1049334977 8:142079478-142079500 GGACACCCTTGCAGCACCCCTGG + Intergenic
1049521243 8:143092509-143092531 GAGCACACATTCTCCACCCTGGG - Intergenic
1052259829 9:26501429-26501451 AGTGACCCATTCTCCACCACTGG + Intergenic
1052358472 9:27529286-27529308 GGTCGCCCACTTTCCACCCCGGG - Intronic
1053153014 9:35754728-35754750 GGAAACACAGTCTCCACTCCAGG - Exonic
1059386147 9:113965990-113966012 GAAGACCCATGGTCCACCCCAGG + Intronic
1060790247 9:126481072-126481094 GAACCCCTACTCTCCACCCCTGG - Intronic
1060827764 9:126696272-126696294 TGACACCCCTTCTGCCCCCCAGG + Exonic
1061429814 9:130523889-130523911 GGACCCCCACGCTCCTCCCCAGG + Intergenic
1061872875 9:133530017-133530039 GGATGTCCATTCTCCACCCGTGG + Intergenic
1062490804 9:136804000-136804022 GGCCACCCCTTCTCCACCCCGGG - Intronic
1186419910 X:9417361-9417383 TCACCCCCATCCTCCACCCCAGG + Intergenic
1187177143 X:16906112-16906134 GTACACCCATTCTGCTCACCAGG - Intergenic
1187846134 X:23540331-23540353 CGCCACCCTTTCCCCACCCCTGG + Intergenic
1190687481 X:52887864-52887886 AGACACCCCTTCCCCACACCAGG + Intergenic
1190698501 X:52967928-52967950 AGACACCCCTTCCCCACACCAGG - Intronic
1194055736 X:89128753-89128775 GGAAACCCATGCTTCACCCATGG - Intergenic
1197465345 X:126798608-126798630 GGCCACCCATCCCCCTCCCCTGG + Intergenic
1198077025 X:133203707-133203729 AGCCACCCCTTCTCCACCCTAGG - Intergenic
1200073644 X:153540873-153540895 GGACACTCGCTCTCCTCCCCAGG + Intronic
1201325923 Y:12757846-12757868 GGCTACCCGTTCTCCACCCTTGG + Intronic