ID: 972245985

View in Genome Browser
Species Human (GRCh38)
Location 4:37245437-37245459
Sequence TCCACCCCGGGTTATTCCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 61
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 56}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972245980_972245985 6 Left 972245980 4:37245408-37245430 CCTGCACACTTCTATTAGGACAC 0: 1
1: 0
2: 1
3: 10
4: 97
Right 972245985 4:37245437-37245459 TCCACCCCGGGTTATTCCCCTGG 0: 1
1: 0
2: 0
3: 4
4: 56
972245976_972245985 25 Left 972245976 4:37245389-37245411 CCCTCGCTGGCCGGTTTTGCCTG 0: 1
1: 0
2: 0
3: 2
4: 69
Right 972245985 4:37245437-37245459 TCCACCCCGGGTTATTCCCCTGG 0: 1
1: 0
2: 0
3: 4
4: 56
972245978_972245985 15 Left 972245978 4:37245399-37245421 CCGGTTTTGCCTGCACACTTCTA 0: 1
1: 0
2: 0
3: 11
4: 146
Right 972245985 4:37245437-37245459 TCCACCCCGGGTTATTCCCCTGG 0: 1
1: 0
2: 0
3: 4
4: 56
972245975_972245985 26 Left 972245975 4:37245388-37245410 CCCCTCGCTGGCCGGTTTTGCCT 0: 1
1: 0
2: 0
3: 2
4: 64
Right 972245985 4:37245437-37245459 TCCACCCCGGGTTATTCCCCTGG 0: 1
1: 0
2: 0
3: 4
4: 56
972245977_972245985 24 Left 972245977 4:37245390-37245412 CCTCGCTGGCCGGTTTTGCCTGC 0: 1
1: 0
2: 0
3: 2
4: 62
Right 972245985 4:37245437-37245459 TCCACCCCGGGTTATTCCCCTGG 0: 1
1: 0
2: 0
3: 4
4: 56

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972245985 Original CRISPR TCCACCCCGGGTTATTCCCC TGG Intronic
902099372 1:13973311-13973333 TCCACCCTGCTTTATTCCCTAGG + Intergenic
904500045 1:30908324-30908346 TCCCCCCCGGCTGCTTCCCCCGG - Intronic
906074898 1:43044983-43045005 TCCACCTCGGCTTATCCTCCTGG - Intergenic
910449497 1:87331484-87331506 TCCCTCCCGGGTTCTGCCCCGGG - Intronic
912488098 1:110045183-110045205 TCCACCCCGGCCTCTACCCCAGG - Intronic
914919056 1:151835327-151835349 TCCAGCCAGGGCTGTTCCCCAGG + Intergenic
920929558 1:210374505-210374527 TCCACACCTTGTTATTCACCGGG + Intronic
1064351894 10:14584343-14584365 TCCACCTTGGGGTTTTCCCCTGG - Intronic
1074613987 10:115048103-115048125 GCCACCCCAGGGCATTCCCCAGG + Intergenic
1076747240 10:132520433-132520455 TCCAGCCCGGGTTCACCCCCTGG - Intergenic
1076991495 11:278448-278470 TCCAGCCCGGTCCATTCCCCGGG - Intronic
1077542972 11:3156169-3156191 CCCACCCCAGGTCAGTCCCCCGG + Intronic
1081175020 11:39917093-39917115 TCCACCCTGGGTTATGCAACAGG - Intergenic
1083234213 11:61341604-61341626 TGCTCCCCAGGTTATTCCCCAGG + Intronic
1099133526 12:78864841-78864863 TGCACCCCGGGCAAGTCCCCAGG + Exonic
1102880802 12:116482996-116483018 TCCACCCCAGGTTAGGCCACTGG + Intergenic
1108702162 13:52953025-52953047 TCCTCCCCGGATTCTTCCCTTGG + Intergenic
1125828543 15:42695118-42695140 TCCACCCCGTGATCTTCCTCAGG + Exonic
1129479846 15:75814957-75814979 TTGACCCCAGGTTACTCCCCAGG - Intergenic
1132632494 16:926558-926580 TCCACCCCGTGTTAACCTCCCGG - Intronic
1141029805 16:80577940-80577962 CCCTCCCCGGGTTATCACCCTGG + Intergenic
1142066865 16:88067772-88067794 TCCACCCCAGGGTAAACCCCAGG + Intronic
1142147648 16:88499218-88499240 TCCACCCCGGGAAAGTCACCTGG + Intronic
1143565320 17:7717291-7717313 TCCAGGCCCGGTTTTTCCCCCGG + Intergenic
1145911950 17:28548151-28548173 TCCACCCAGGGTTCTACCCTTGG + Intronic
1148758546 17:49987372-49987394 TCCTCCCTGGGTTCTTCCCTGGG - Intergenic
1155619544 18:27761613-27761635 TCTACCCCTTATTATTCCCCAGG + Intergenic
1164178324 19:22797514-22797536 TCAACCCCGGGTATTTACCCTGG + Intergenic
925108501 2:1313363-1313385 TCCACCCAAGTTTATCCCCCAGG + Intronic
929980044 2:46669594-46669616 TCCTCCCCTGGTTTCTCCCCAGG + Intergenic
937983315 2:127627406-127627428 TCCACCCCGGCCTGTTACCCGGG - Intronic
1169268124 20:4180075-4180097 TCCTCCCTGGGTTTTTCCCTTGG - Intronic
1172240935 20:33412185-33412207 TCCACCCTCAGCTATTCCCCAGG - Intronic
1176689342 21:9884031-9884053 TCCACCCTGAGTGATCCCCCTGG - Intergenic
1181809647 22:25395615-25395637 TCCACCTTGGGTTCTGCCCCAGG - Intronic
1182482074 22:30615504-30615526 TCCACCCCTGACTGTTCCCCAGG - Intronic
1183351217 22:37335673-37335695 TCTCCCCCGGCTCATTCCCCAGG - Intergenic
955341536 3:58129120-58129142 TCCACTCCGGGTTTTTAACCAGG - Intronic
972245985 4:37245437-37245459 TCCACCCCGGGTTATTCCCCTGG + Intronic
972745460 4:41928064-41928086 TCCTCCCCTGATTCTTCCCCTGG + Intergenic
974529445 4:63088907-63088929 TGCACTCCAGGTTATTCCCGTGG - Intergenic
982064342 4:151639871-151639893 TCCACCCACCCTTATTCCCCAGG - Intronic
984291670 4:177803270-177803292 TCCACCCCTGTTTGTTCCCAAGG + Intronic
992018053 5:72595607-72595629 TGCACCCCGGGCTAGGCCCCAGG + Intergenic
994934187 5:106232206-106232228 TCCACACTGGTTTATTCCCAAGG + Intergenic
995518079 5:112974112-112974134 GCCACACAGGGTCATTCCCCTGG + Intergenic
997253091 5:132406476-132406498 TCCACCGCTGGTTCTTCCCATGG - Intergenic
1000551484 5:162670977-162670999 TCCACCCCAGGTTTTTCTGCTGG - Intergenic
1002644448 5:180646289-180646311 TCCACCCCAGTTTATCCCCTGGG + Intronic
1007098035 6:39226524-39226546 CCCACCCCTGGTTGTACCCCAGG + Intronic
1016651776 6:146469995-146470017 TCCACCCAGGGTTGCTCACCTGG - Intergenic
1018892157 6:167990033-167990055 TCCACGCCGGGTGAGTCCCCGGG + Intergenic
1018892173 6:167990090-167990112 TCCACGCCGGGTGAGTCCCCGGG + Intergenic
1018892188 6:167990147-167990169 TCCACGCCCGGTGAGTCCCCGGG + Intergenic
1023077406 7:36497980-36498002 CCCACCCCGGGATTTTCCACGGG - Intergenic
1032027600 7:128455999-128456021 TCCACTCCCGGCTGTTCCCCCGG + Exonic
1037928731 8:22865129-22865151 TCCAGCACTGGTTCTTCCCCGGG - Intronic
1040284082 8:46091240-46091262 TCCAACCCGGGGGATGCCCCAGG - Intergenic
1048456597 8:134584178-134584200 TCCACGCCAGGTTCTTCCCCAGG + Intronic
1058718841 9:107745306-107745328 TCCACCCCTGGCTGTTTCCCTGG - Intergenic
1189862835 X:45290984-45291006 TCCACCCTGGTTTACTCCCAAGG - Intergenic