ID: 972245987

View in Genome Browser
Species Human (GRCh38)
Location 4:37245438-37245460
Sequence CCACCCCGGGTTATTCCCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 76
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 72}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972245978_972245987 16 Left 972245978 4:37245399-37245421 CCGGTTTTGCCTGCACACTTCTA 0: 1
1: 0
2: 0
3: 11
4: 146
Right 972245987 4:37245438-37245460 CCACCCCGGGTTATTCCCCTGGG 0: 1
1: 0
2: 0
3: 3
4: 72
972245980_972245987 7 Left 972245980 4:37245408-37245430 CCTGCACACTTCTATTAGGACAC 0: 1
1: 0
2: 1
3: 10
4: 97
Right 972245987 4:37245438-37245460 CCACCCCGGGTTATTCCCCTGGG 0: 1
1: 0
2: 0
3: 3
4: 72
972245976_972245987 26 Left 972245976 4:37245389-37245411 CCCTCGCTGGCCGGTTTTGCCTG 0: 1
1: 0
2: 0
3: 2
4: 69
Right 972245987 4:37245438-37245460 CCACCCCGGGTTATTCCCCTGGG 0: 1
1: 0
2: 0
3: 3
4: 72
972245977_972245987 25 Left 972245977 4:37245390-37245412 CCTCGCTGGCCGGTTTTGCCTGC 0: 1
1: 0
2: 0
3: 2
4: 62
Right 972245987 4:37245438-37245460 CCACCCCGGGTTATTCCCCTGGG 0: 1
1: 0
2: 0
3: 3
4: 72
972245975_972245987 27 Left 972245975 4:37245388-37245410 CCCCTCGCTGGCCGGTTTTGCCT 0: 1
1: 0
2: 0
3: 2
4: 64
Right 972245987 4:37245438-37245460 CCACCCCGGGTTATTCCCCTGGG 0: 1
1: 0
2: 0
3: 3
4: 72

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972245987 Original CRISPR CCACCCCGGGTTATTCCCCT GGG Intronic
901867464 1:12116508-12116530 CCACGCCTGGCCATTCCCCTTGG - Intronic
902654587 1:17858844-17858866 CCACCCACGGTCTTTCCCCTAGG - Intergenic
909956116 1:81781204-81781226 CCACTCCATGTTATTCACCTTGG - Intronic
913646216 1:120857349-120857371 CCAGCCAGGGCTATTCCCCCAGG - Intergenic
914080429 1:144405533-144405555 CCAGCCAGGGCTATTCCCCCAGG + Intergenic
914175336 1:145274057-145274079 CCAGCCAGGGCTATTCCCCCAGG + Intergenic
914530058 1:148515536-148515558 CCAGCCAGGGCTATTCCCCCAGG + Intergenic
917675532 1:177315706-177315728 CAACCCCGGGTTCTTCCCAGAGG - Intergenic
921708351 1:218348615-218348637 CCACCCCTGGTTATCCCCTTTGG + Intronic
1063534998 10:6874903-6874925 CCAACCTGGGTCATTCCCATAGG + Intergenic
1072741635 10:97913468-97913490 CCTCTCTGGGTTATACCCCTAGG - Intronic
1074613989 10:115048104-115048126 CCACCCCAGGGCATTCCCCAGGG + Intergenic
1076747238 10:132520432-132520454 CCAGCCCGGGTTCACCCCCTGGG - Intergenic
1077401925 11:2363154-2363176 CCACCCCGGTTCCTTCCCCCAGG + Intergenic
1077542974 11:3156170-3156192 CCACCCCAGGTCAGTCCCCCGGG + Intronic
1083234214 11:61341605-61341627 GCTCCCCAGGTTATTCCCCAGGG + Intronic
1084041913 11:66547312-66547334 CCACCAGGGTTCATTCCCCTGGG + Intronic
1084135910 11:67181449-67181471 CCACCACTGTTTATTGCCCTGGG - Intronic
1088461382 11:110086993-110087015 ACATCCCTGGATATTCCCCTTGG + Intergenic
1097838987 12:64302651-64302673 CCACACCAGGTCACTCCCCTGGG + Intronic
1103885361 12:124196400-124196422 CCTCCCCGAGTTATTTCCCAAGG + Intronic
1104578967 12:129995284-129995306 CCACCCTGGGCTCTTCCACTTGG + Intergenic
1108702164 13:52953026-52953048 CCTCCCCGGATTCTTCCCTTGGG + Intergenic
1129622797 15:77164862-77164884 CCTTCCTGGGTTAGTCCCCTTGG - Intronic
1129797239 15:78387174-78387196 CCACCCCCTGTCTTTCCCCTGGG + Intergenic
1130295803 15:82646781-82646803 CCACCCGGCGTCATTCCCCGAGG - Intronic
1130667263 15:85880199-85880221 CCACCCTGGGTGATCCCCATAGG + Intergenic
1130915681 15:88302781-88302803 CCACCCCTGGTTCTCACCCTAGG + Intergenic
1136373377 16:29849733-29849755 CCACCCTGGGCTCCTCCCCTTGG + Intergenic
1142147650 16:88499219-88499241 CCACCCCGGGAAAGTCACCTGGG + Intronic
1143328316 17:6116138-6116160 CCACTCTGGCTTAGTCCCCTAGG + Intronic
1145911952 17:28548152-28548174 CCACCCAGGGTTCTACCCTTGGG + Intronic
1148178276 17:45585612-45585634 CCACCCCGACTAATTTCCCTCGG - Intergenic
1150408178 17:64919903-64919925 CCACCCCGACTAATTTCCCTCGG - Intergenic
1151208905 17:72529125-72529147 CCATCCTGGGTTATTACCCCTGG + Intergenic
1159907861 18:74114187-74114209 GCACCCCGGGTTTTTACTCTGGG - Intronic
932732979 2:74233507-74233529 CCACCACGGGTTCTTCCCAAAGG + Exonic
943320376 2:186436538-186436560 CCACCCAGGGCTTTTGCCCTGGG - Intergenic
944200215 2:197098915-197098937 CCACCCTGGGTCCTGCCCCTCGG + Intronic
1169268122 20:4180074-4180096 CCTCCCTGGGTTTTTCCCTTGGG - Intronic
1171448728 20:25221977-25221999 CCGCCCCGTGTTATTTCTCTTGG - Intronic
1173184588 20:40830913-40830935 CCAGCCTGGGATATTCCCATGGG + Intergenic
1176060743 20:63171640-63171662 CCACCCCAGGCCATTGCCCTAGG - Intergenic
1176689340 21:9884030-9884052 CCACCCTGAGTGATCCCCCTGGG - Intergenic
1184091084 22:42293387-42293409 CCACCTGGTTTTATTCCCCTGGG - Intronic
955325869 3:58009011-58009033 CCTCCCCGGTGTCTTCCCCTGGG + Intronic
961808591 3:129507378-129507400 CCCTCCCAGATTATTCCCCTGGG - Intronic
963756818 3:149243087-149243109 CCACCCCGCGTCATCCTCCTTGG + Intergenic
969480720 4:7445538-7445560 CCAGCCCTGGTGCTTCCCCTCGG - Intronic
972245987 4:37245438-37245460 CCACCCCGGGTTATTCCCCTGGG + Intronic
972745462 4:41928065-41928087 CCTCCCCTGATTCTTCCCCTGGG + Intergenic
975310808 4:72901418-72901440 CTACCACGGGTTATTCCTGTTGG + Intergenic
980996811 4:139786898-139786920 CCACCCCTGCTTATTCCACCCGG + Intronic
991609303 5:68434326-68434348 CCTCCCCAGGTAATTCCCCTCGG - Intergenic
995518081 5:112974113-112974135 CCACACAGGGTCATTCCCCTGGG + Intergenic
997866180 5:137464800-137464822 CCAGTCCAGGTTATTCTCCTAGG - Intronic
1000551482 5:162670976-162670998 CCACCCCAGGTTTTTCTGCTGGG - Intergenic
1006380610 6:33695111-33695133 CCACCCTGGGTTCTATCCCTGGG + Intronic
1017978358 6:159377002-159377024 CCACCCCGGGTCTGTCCTCTAGG - Intergenic
1018670019 6:166169533-166169555 CCACCTCGGGTCAGCCCCCTGGG - Intergenic
1018892159 6:167990034-167990056 CCACGCCGGGTGAGTCCCCGGGG + Intergenic
1018892175 6:167990091-167990113 CCACGCCGGGTGAGTCCCCGGGG + Intergenic
1019516242 7:1441431-1441453 CCACCAGGGGTTAGCCCCCTGGG - Intronic
1023077404 7:36497979-36498001 CCACCCCGGGATTTTCCACGGGG - Intergenic
1025256114 7:57384906-57384928 CACCCCTGGTTTATTCCCCTGGG - Intergenic
1027144994 7:75688245-75688267 CCACCAGGGGTTCCTCCCCTGGG + Intronic
1033249665 7:139747741-139747763 GCACCCCCGGTTTTTCCCTTGGG + Intronic
1044781963 8:95752506-95752528 CTACTCAGGGTCATTCCCCTTGG - Intergenic
1047767605 8:128002221-128002243 CCGCCCTGGGTGATTCCCCATGG + Intergenic
1049208007 8:141372296-141372318 CCACCCCGGGACCTTCCACTTGG + Intergenic
1057023879 9:91721475-91721497 CCACCCCGGTCTATTGCCATTGG + Intronic
1062302702 9:135884313-135884335 CCACAGCTGGTTCTTCCCCTGGG - Intronic
1062628120 9:137452141-137452163 CCACCCCAGCCTCTTCCCCTTGG + Intronic
1062680667 9:137778106-137778128 GCACCCCGCGTTTTTCCCCATGG + Intronic
1187448333 X:19376380-19376402 CCTCCCCGAGGCATTCCCCTGGG + Intronic
1199190573 X:144965039-144965061 CCACCCCAGGATTTTTCCCTCGG + Intergenic