ID: 972245994

View in Genome Browser
Species Human (GRCh38)
Location 4:37245460-37245482
Sequence GTCAATCCAAGAAACATCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 176
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 158}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972245990_972245994 -6 Left 972245990 4:37245443-37245465 CCGGGTTATTCCCCTGGGTCAAT 0: 1
1: 0
2: 0
3: 12
4: 84
Right 972245994 4:37245460-37245482 GTCAATCCAAGAAACATCCAAGG 0: 1
1: 0
2: 0
3: 17
4: 158
972245986_972245994 -1 Left 972245986 4:37245438-37245460 CCACCCCGGGTTATTCCCCTGGG 0: 1
1: 0
2: 0
3: 9
4: 93
Right 972245994 4:37245460-37245482 GTCAATCCAAGAAACATCCAAGG 0: 1
1: 0
2: 0
3: 17
4: 158
972245989_972245994 -5 Left 972245989 4:37245442-37245464 CCCGGGTTATTCCCCTGGGTCAA 0: 1
1: 0
2: 0
3: 9
4: 94
Right 972245994 4:37245460-37245482 GTCAATCCAAGAAACATCCAAGG 0: 1
1: 0
2: 0
3: 17
4: 158
972245983_972245994 7 Left 972245983 4:37245430-37245452 CCCATTCTCCACCCCGGGTTATT 0: 1
1: 0
2: 1
3: 11
4: 82
Right 972245994 4:37245460-37245482 GTCAATCCAAGAAACATCCAAGG 0: 1
1: 0
2: 0
3: 17
4: 158
972245988_972245994 -4 Left 972245988 4:37245441-37245463 CCCCGGGTTATTCCCCTGGGTCA 0: 1
1: 0
2: 0
3: 4
4: 93
Right 972245994 4:37245460-37245482 GTCAATCCAAGAAACATCCAAGG 0: 1
1: 0
2: 0
3: 17
4: 158
972245984_972245994 6 Left 972245984 4:37245431-37245453 CCATTCTCCACCCCGGGTTATTC 0: 1
1: 0
2: 0
3: 10
4: 122
Right 972245994 4:37245460-37245482 GTCAATCCAAGAAACATCCAAGG 0: 1
1: 0
2: 0
3: 17
4: 158
972245980_972245994 29 Left 972245980 4:37245408-37245430 CCTGCACACTTCTATTAGGACAC 0: 1
1: 0
2: 1
3: 10
4: 97
Right 972245994 4:37245460-37245482 GTCAATCCAAGAAACATCCAAGG 0: 1
1: 0
2: 0
3: 17
4: 158

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972245994 Original CRISPR GTCAATCCAAGAAACATCCA AGG Intronic
902336023 1:15755454-15755476 GAGAATCCAAGGAACATCCATGG - Intergenic
904601399 1:31674565-31674587 GTCAATCCAGAAAGAATCCAGGG - Intronic
905329967 1:37187589-37187611 GTCATCCCAGGAAACATCCCAGG + Intergenic
905796428 1:40818935-40818957 TTCAAACCCAGAAGCATCCAGGG - Intronic
912136369 1:106664234-106664256 CTCAAACCAAAAAACATACAAGG + Intergenic
917715788 1:177735900-177735922 GTCATTCAAAGAAATCTCCAAGG + Intergenic
917912803 1:179668664-179668686 TTCAATTCAAGAAACATTTATGG - Intronic
919497507 1:198292685-198292707 ATCAATCCAAGAAGAATCAACGG - Intronic
921789029 1:219268421-219268443 GTGCATCCAAGAACCATCAAGGG + Intergenic
921995566 1:221414165-221414187 GTCAATCCATGGCACAGCCAGGG - Intergenic
923018285 1:230143607-230143629 GTAAAGCCAAGAAAAAACCAAGG - Intronic
923405133 1:233652254-233652276 GTAAATTCTGGAAACATCCAGGG + Intronic
923808952 1:237291123-237291145 TTCAATCCAAGAAATATACCTGG + Intronic
1063352912 10:5373057-5373079 GTCAGACCAAGTATCATCCAGGG - Intronic
1066750566 10:38652115-38652137 GTCAGTCCCAGAAACATTCAAGG + Intergenic
1066966483 10:42270997-42271019 GTCAGTCCTAGAAACATTCAAGG - Intergenic
1069037215 10:63657954-63657976 GTCAATCTGAGAACCATCTAGGG + Intergenic
1069051690 10:63802116-63802138 ATCAAGCCAAGAAACCTGCAAGG + Intergenic
1070968665 10:80545630-80545652 AACAATGCAAGCAACATCCATGG - Intronic
1078596505 11:12691637-12691659 GTCAAACCACAAACCATCCATGG - Intronic
1082567775 11:54700851-54700873 GCCAAGCCAAGAAAAATACAGGG - Intergenic
1084746564 11:71173861-71173883 CACAAGCCAAGGAACATCCAGGG + Intronic
1087366095 11:97220533-97220555 ATGAATCCATGAAACATGCAGGG - Intergenic
1089528875 11:119113796-119113818 TCCAATCCAAGAAAGAGCCAGGG + Intronic
1091328429 11:134711119-134711141 GACAAGCTAAGAAACATCCCTGG + Intergenic
1091862503 12:3798692-3798714 ATCAAAACAAAAAACATCCATGG + Intronic
1093705883 12:22274727-22274749 GTCAATCCAGGCAACAGCGATGG - Intronic
1098389373 12:69952909-69952931 GTAAATTCCAGAAACAACCAGGG - Intronic
1098618674 12:72563319-72563341 TTTAATTCAAGAAACATTCATGG - Intronic
1103580205 12:121909139-121909161 GTCAATCAAAGAGACATTTAGGG + Intronic
1105704772 13:22962152-22962174 GTCAGTCCAAGCAACAGTCAGGG + Intergenic
1108371666 13:49775570-49775592 ATCAAACCATGAAACATTCAAGG + Intronic
1113381385 13:109809284-109809306 ATTCATCCAACAAACATCCATGG + Intergenic
1114540143 14:23449332-23449354 GTCATTCATAGAAACTTCCAGGG + Intergenic
1114568863 14:23651791-23651813 GTAACTCCAAGAGACAGCCACGG - Intergenic
1118082309 14:62374627-62374649 GTCACTCCATGAAAGATCCCTGG - Intergenic
1118690467 14:68334137-68334159 GTCAACCCTAGAAAAATGCAGGG + Intronic
1118997234 14:70847581-70847603 CTCAACCAAAGAAACAGCCATGG + Intergenic
1122002674 14:98674655-98674677 GTAAAGCCAAGAAACCTCCTGGG - Intergenic
1124808238 15:32907608-32907630 GTCAGCCCTAGAAACTTCCAAGG - Intronic
1125515063 15:40314183-40314205 CTCATTCCAAGATGCATCCAGGG + Intergenic
1132236380 15:100224974-100224996 GTGGATCCATGACACATCCAGGG - Intronic
1133563504 16:6971311-6971333 GTCAGCCACAGAAACATCCATGG + Intronic
1133896146 16:9930992-9931014 GTCAATCCAAAACACATAAATGG + Intronic
1134302669 16:13005586-13005608 GTCAATCCAAGAACCCTCATGGG - Intronic
1136575479 16:31121709-31121731 ATCAATACAAGAAAAAACCAAGG - Intronic
1136732157 16:32424971-32424993 GTCAGTCCTAGAAACATTCAAGG - Intergenic
1137409116 16:48213113-48213135 TTCAATGCAAGCAACATCTATGG + Intronic
1141837541 16:86552396-86552418 GTCACCCAAAGAAACATCTAAGG + Intronic
1141933921 16:87223819-87223841 GTCAATCCACAAAAATTCCAAGG + Intronic
1202994238 16_KI270728v1_random:92273-92295 GTCAGTCCTAGAAACATTCAAGG + Intergenic
1203020925 16_KI270728v1_random:404615-404637 GTCAGTCCTAGAAACATTCAAGG + Intergenic
1203039260 16_KI270728v1_random:677773-677795 GTCAGTCCTAGAAACATTCAAGG + Intergenic
1144152735 17:12465844-12465866 GTGAAGCCAAGAACCCTCCAAGG + Intergenic
1144998578 17:19287922-19287944 GACAATTCAAGAGACTTCCAAGG - Intronic
1147557289 17:41487506-41487528 GTCAAACCAAGCTACTTCCAAGG + Intronic
1147797713 17:43057086-43057108 GTCAATGGAAGAAACCACCAAGG - Exonic
1151138828 17:71972449-71972471 CACAACCCAAGGAACATCCAGGG - Intergenic
1151296147 17:73187613-73187635 GTCAATAAAAGTAACATCCGGGG - Intergenic
1151529986 17:74698096-74698118 GTCAATCCAGGAAAGAGACAGGG + Intronic
1152272016 17:79330334-79330356 GGCAATTCCAGAACCATCCAGGG - Intronic
1156631747 18:38978231-38978253 ATCACTCCAAGAAAGATTCAGGG - Intergenic
1158579616 18:58670661-58670683 GCCAATCTTAGCAACATCCAAGG - Intergenic
1159045577 18:63366697-63366719 GTGAATCCATGCAACATCCCTGG - Intronic
1159434837 18:68402723-68402745 ATCATGCCAAGAAACATCTATGG + Intergenic
1161859960 19:6790578-6790600 GTGAAGCCAAGAACCCTCCAGGG - Intronic
1162990779 19:14300767-14300789 GTGAATCTAAGAACCCTCCAGGG + Intergenic
1164231512 19:23292337-23292359 CTCAAACCAAAAAACATACAAGG + Intergenic
1164817393 19:31215415-31215437 GTGTATACAAGAAATATCCATGG + Intergenic
926512268 2:13796954-13796976 CTCAAACCAAAAAACATACAAGG - Intergenic
926625789 2:15088779-15088801 GTAAAACCAAGATAGATCCAAGG + Intergenic
927356527 2:22179497-22179519 ACCAATGGAAGAAACATCCAGGG - Intergenic
928233943 2:29523742-29523764 TTCAATCCATCAAACATCCAGGG + Intronic
928314335 2:30234102-30234124 GTCATTTAAAGAAACATTCAGGG + Intronic
928647613 2:33371238-33371260 GTCAGTCCATGATACATCCATGG - Intronic
928668250 2:33573716-33573738 GACAATCCAAAATAAATCCAAGG + Intergenic
928983836 2:37161324-37161346 GTCAAGCCCAGAATCATCAAGGG + Intergenic
929637435 2:43538718-43538740 GGCAAACCAGGTAACATCCAGGG + Intronic
933107283 2:78346708-78346730 CACAATCCTAGAAAAATCCAAGG - Intergenic
933708411 2:85308106-85308128 TTCAACCAAAGAAACATCCAAGG - Intronic
937855933 2:126672038-126672060 GTCTGACCAAGACACATCCAGGG + Intronic
939459331 2:142479173-142479195 GTCAATTCAAGGCACAGCCAAGG - Intergenic
943030547 2:182680725-182680747 GTGAAGCCAAGAAACTTCCTGGG - Intergenic
943485257 2:188471532-188471554 CTCAAACCAAAAAACATACAAGG - Intronic
944484933 2:200195501-200195523 TTCAATCTAAGAAACATTTATGG - Intergenic
945246519 2:207722374-207722396 GTAAATATAAGAAATATCCAAGG - Intronic
946461150 2:219870033-219870055 GTAAAACCAAGAAAAAGCCAAGG - Intergenic
1170686982 20:18578070-18578092 GTGAATCAAAGTAACATCCAAGG + Intronic
1171230427 20:23479972-23479994 ATCACTGCCAGAAACATCCATGG - Intergenic
1173647266 20:44641234-44641256 GTCAATTAAAGAAAAATCCTTGG + Intronic
1174164776 20:48576887-48576909 GAGAATCCAAGAAAGTTCCATGG + Intergenic
1177583992 21:23065407-23065429 GTTATTCCAAGAAATATGCAGGG - Intergenic
1178690158 21:34743848-34743870 GTCAAGCCAAGACAAACCCAGGG - Intergenic
1180540307 22:16440176-16440198 GTCAGTCCTAGAAACACTCAAGG + Intergenic
1180581507 22:16843502-16843524 CTCATTCCAAGAAACTGCCATGG + Intergenic
1182017937 22:27056408-27056430 GAAAATCCAAGGAGCATCCAAGG + Intergenic
949664587 3:6322456-6322478 GGCAATCCTAGAAAAAACCATGG + Intergenic
957494830 3:80978894-80978916 CTCGTTTCAAGAAACATCCAAGG - Intergenic
959209763 3:103362901-103362923 GTCAATCCAAGAAACAAATCAGG + Intergenic
961095117 3:124147895-124147917 TTCAATCCAAAAAACATCTGAGG - Intronic
961599168 3:128045785-128045807 GAATACCCAAGAAACATCCAGGG - Intergenic
963540220 3:146577335-146577357 GCCAAACCAAGACACATCCATGG - Intronic
963730009 3:148962073-148962095 GTCAAGCAAAGGACCATCCATGG + Intergenic
965700421 3:171455120-171455142 GGCCATCAAAGAAACATACAAGG + Intronic
966239309 3:177738530-177738552 ATTAAACCAAGAAACATCTATGG + Intergenic
967197180 3:187038605-187038627 CTCAATCCAGGAAGCCTCCAGGG - Intronic
970366069 4:15359546-15359568 GTCAATCCCAAATACTTCCAAGG + Intronic
972245994 4:37245460-37245482 GTCAATCCAAGAAACATCCAAGG + Intronic
972711173 4:41596666-41596688 GTCAATCAATGAAACATATATGG + Intronic
973097998 4:46226306-46226328 GTAAATCCAAATAAAATCCAGGG + Intergenic
974509222 4:62816028-62816050 TTCTAACCAAGATACATCCAAGG + Intergenic
977945769 4:102912323-102912345 GTCAGTCCTAGAAACATTCAAGG + Intronic
978067089 4:104418547-104418569 GTAAATGCATGAATCATCCAAGG + Intergenic
978172858 4:105694825-105694847 GACAATCCAAGAATCATCTTTGG + Intronic
979595788 4:122532598-122532620 ATAAATCCAACAAAAATCCAGGG - Intergenic
981779613 4:148412170-148412192 GTGAACACAATAAACATCCAAGG + Intronic
982219639 4:153113538-153113560 GTCAATACTAGAATCAGCCAAGG - Intergenic
984100688 4:175481924-175481946 CACAAGCCAAGGAACATCCAGGG - Intergenic
986819693 5:11452002-11452024 GTGATTACAAGAATCATCCAAGG + Intronic
986937884 5:12914127-12914149 TTAAATCCAGGAAACATCCTTGG - Intergenic
987240551 5:15994189-15994211 GCACATCCAAGAAACACCCAAGG + Intergenic
987636578 5:20550537-20550559 GTCCATCAAAGAAACATCTAGGG + Intronic
989722532 5:44546740-44546762 GTCAATAGAAGAAACATACTTGG - Intergenic
990036541 5:51328296-51328318 ATCAATTCAATAAATATCCAAGG + Intergenic
992130584 5:73688507-73688529 ATCAATCCAAGCAAAATGCATGG - Intronic
993294464 5:86117973-86117995 GTCAATCAAAGAAAGATTTAAGG - Intergenic
993346947 5:86795940-86795962 GTCAAAACAAGAATAATCCAGGG - Intergenic
993660788 5:90631642-90631664 TCCACTCCAAGAAAAATCCAAGG - Intronic
994238301 5:97391494-97391516 GCAAAGCCAAGAAACTTCCAAGG + Intergenic
995471465 5:112506114-112506136 GTCAATATCAGAAACATCAACGG + Intergenic
997371849 5:133366717-133366739 TTCAGTCCAAGGAACATCAACGG + Intronic
1000718015 5:164670890-164670912 ATCAATCAAAGAAACCTGCATGG - Intergenic
1006824974 6:36928238-36928260 ATCAATCCAAGAATGAGCCATGG + Intronic
1008012463 6:46482973-46482995 GTCATTCCATGAATCATACATGG + Intronic
1009245661 6:61233951-61233973 CTCAAACCAAAAAACATACAAGG + Intergenic
1011184902 6:84663265-84663287 ATCTATCCAACAAACCTCCATGG + Intergenic
1012333911 6:98030003-98030025 GTGAACCCAAGATACACCCATGG - Intergenic
1012628161 6:101430186-101430208 TTAAATCCAAGATACATACAGGG + Intronic
1012759296 6:103278121-103278143 GTGAAGCCAAGAAACTTCCCAGG - Intergenic
1014155211 6:118101980-118102002 GTCAATCTTGCAAACATCCAGGG - Intronic
1021381025 7:19966532-19966554 GTAAATACAGGAAATATCCAAGG - Intergenic
1022384650 7:29889943-29889965 GTCATTCCAACATACAGCCAAGG + Intronic
1022716670 7:32905200-32905222 GTGAAGCCAAGAAACTTCCTGGG - Intergenic
1024623682 7:51186189-51186211 CTCAATTCTAGAAACATCCTTGG - Intronic
1026134915 7:67651434-67651456 CTCAATCCAACACACAGCCAGGG - Intergenic
1027724134 7:81781937-81781959 GTAAATACAAGAGTCATCCAAGG - Intergenic
1029747788 7:102525907-102525929 GTCTATCCAGCAAGCATCCATGG - Intergenic
1029765739 7:102624997-102625019 GTCTATCCAGCAAGCATCCATGG - Intronic
1030103324 7:105965575-105965597 GTCAATCCAGGAAGACTCCATGG - Intronic
1030201443 7:106909631-106909653 CCCAACCCAAGTAACATCCAAGG + Intergenic
1031323374 7:120361939-120361961 GTGGATCCAATAAACATCAATGG + Intronic
1032636462 7:133714321-133714343 GACTATGGAAGAAACATCCAAGG - Intronic
1032641376 7:133772901-133772923 CTCAAGCTCAGAAACATCCAGGG - Intronic
1038865811 8:31437769-31437791 GTAAATTCAGCAAACATCCAAGG + Intergenic
1040324713 8:46335864-46335886 TCCAATCCAAGAAGCTTCCAGGG + Intergenic
1042475066 8:69238645-69238667 GTCAGTCTAAGAATCTTCCAAGG + Intergenic
1045009488 8:97945115-97945137 GTGAATCAAATAAACAACCAGGG + Intronic
1045915604 8:107466562-107466584 GTAAAGCCAAGGAAAATCCAAGG + Intronic
1046059285 8:109117203-109117225 GAAAATGCAAGAAACATTCATGG + Intronic
1047190132 8:122671498-122671520 GTCAATCCAAGAAAGAGCAAAGG + Intergenic
1051924609 9:22308784-22308806 GGCCATCCAAGCAGCATCCAAGG - Intergenic
1052882658 9:33613646-33613668 GCCAATCCACGAAACAGCAAGGG - Intergenic
1052901330 9:33796954-33796976 GCCAATCCATGAAACAGCAAGGG + Intronic
1055289157 9:74764458-74764480 TACAAGCCAAGGAACATCCACGG + Intronic
1060708353 9:125830235-125830257 GCAAATCTAAGAAACATGCAAGG - Intronic
1188625934 X:32285179-32285201 GGCTATCCAAGAAACCTCAACGG + Intronic
1188810426 X:34647828-34647850 ATCAATTTAAGAAACATACATGG + Intronic
1189232483 X:39463486-39463508 GTCATTACCAGACACATCCATGG + Intergenic
1191130958 X:57010041-57010063 TTCAAACCAAAAAACATACAAGG - Intergenic
1191949068 X:66568956-66568978 CTCAAACCAAAAAACATACAAGG - Intergenic
1193668373 X:84352284-84352306 GTCAATGCTAAACACATCCAAGG - Intronic
1193930805 X:87548747-87548769 CTCAAACCAAAAAACATACATGG + Intronic
1195321862 X:103727391-103727413 GTTAATCCAAGAAACATCGCAGG - Intronic
1196374240 X:115014600-115014622 GTCAAGCTTAGAAACCTCCATGG + Intronic
1197710867 X:129666225-129666247 GTCCATCTAAAAAACATCCCAGG + Intergenic
1201181482 Y:11351763-11351785 GTCAGTCCTAGAAACATTCAAGG + Intergenic