ID: 972251592

View in Genome Browser
Species Human (GRCh38)
Location 4:37308554-37308576
Sequence GGTCCCTGGGGAGCATGCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 252
Summary {0: 1, 1: 0, 2: 5, 3: 21, 4: 225}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972251585_972251592 -3 Left 972251585 4:37308534-37308556 CCCAGGTAAACCAGACCTTGGGT 0: 1
1: 0
2: 0
3: 10
4: 110
Right 972251592 4:37308554-37308576 GGTCCCTGGGGAGCATGCACAGG 0: 1
1: 0
2: 5
3: 21
4: 225
972251586_972251592 -4 Left 972251586 4:37308535-37308557 CCAGGTAAACCAGACCTTGGGTC 0: 1
1: 0
2: 0
3: 12
4: 73
Right 972251592 4:37308554-37308576 GGTCCCTGGGGAGCATGCACAGG 0: 1
1: 0
2: 5
3: 21
4: 225
972251580_972251592 18 Left 972251580 4:37308513-37308535 CCATTAGTGGCAGGAGCAGACCC 0: 1
1: 1
2: 1
3: 3
4: 127
Right 972251592 4:37308554-37308576 GGTCCCTGGGGAGCATGCACAGG 0: 1
1: 0
2: 5
3: 21
4: 225
972251583_972251592 -2 Left 972251583 4:37308533-37308555 CCCCAGGTAAACCAGACCTTGGG 0: 1
1: 0
2: 1
3: 9
4: 122
Right 972251592 4:37308554-37308576 GGTCCCTGGGGAGCATGCACAGG 0: 1
1: 0
2: 5
3: 21
4: 225

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972251592 Original CRISPR GGTCCCTGGGGAGCATGCAC AGG Intronic
900083887 1:877601-877623 TGTCCTAGGGGAGCAAGCACAGG + Intergenic
900158136 1:1211737-1211759 GGTCCCTCCGGAGCAGGTACAGG + Exonic
900191897 1:1355597-1355619 GGTCCCAGTGGAGCACGCGCTGG + Exonic
900461085 1:2802375-2802397 GGTCCCTGGGCAGTAGGCTCAGG - Intergenic
900481263 1:2900555-2900577 GGTCCCCTGGGAGAAGGCACAGG - Intergenic
900673479 1:3869968-3869990 AATCCCTGGGGAGCTTGCAGAGG + Intronic
901158264 1:7155132-7155154 GGTCCCTGGGAAGCCTGTGCCGG + Intronic
901232109 1:7647090-7647112 GGTCCCTGGAGAGCAGGTGCTGG - Intronic
901322417 1:8347941-8347963 GCTCCCTGGGGAGCGAGCCCTGG - Intergenic
903792924 1:25906625-25906647 GGCGCCTGGGGAGCATCCCCAGG + Intronic
904828994 1:33294812-33294834 GGTCCTTGGGGAGCATGGGCAGG + Intronic
905362973 1:37432976-37432998 GGTCTTTGGGGAGGCTGCACGGG + Intergenic
906050069 1:42863555-42863577 GGTCCCTGGACAGCATGCACAGG - Intergenic
906188468 1:43880032-43880054 TGTCCCAGGGGAGCATGAATTGG + Intronic
907164034 1:52394247-52394269 GGTTCCTGGGGACAATCCACTGG + Intronic
907781853 1:57574168-57574190 GGTCCCTGGGGAGAAGGCCATGG + Intronic
911083449 1:93956643-93956665 GGTCCCTGGGGAGTATACACCGG + Intergenic
912363315 1:109112865-109112887 GGCCCCTGGGGAGGAAGCTCCGG + Intronic
912550754 1:110483796-110483818 GGTCTCTGGGCAGAAAGCACAGG + Intergenic
915169695 1:153969114-153969136 GGGCCCTGGAGAGGATGCAGGGG + Exonic
916498024 1:165362646-165362668 GGTCCTCGGGGACAATGCACAGG + Intergenic
918533744 1:185551561-185551583 GCTCCCTGGAGGGCATGCCCTGG - Intergenic
920655126 1:207868920-207868942 GCTCCCTGGGGACGATGCCCAGG - Intergenic
920807158 1:209245734-209245756 TGTACCTGGGGAGCAGGCAGTGG + Intergenic
920854796 1:209653492-209653514 TGGCCCTGGAGAGCCTGCACTGG + Intergenic
924093289 1:240524584-240524606 GGTCCCTGGGGAATTTGTACTGG - Intronic
924243849 1:242062940-242062962 TGTCCTAGGGGAGCAAGCACAGG + Intergenic
1062763354 10:44334-44356 TGTCCTAGGGGAGCAAGCACAGG - Intergenic
1064464730 10:15567730-15567752 GGGCCCTGGGGACAATTCACAGG + Intronic
1066648731 10:37635977-37635999 GGTCAGTGGGGAGCATGGACAGG + Intergenic
1067031616 10:42881667-42881689 GGTCAGTGGGGAGCATGGACAGG + Intergenic
1067854934 10:49783965-49783987 GGGCCCTGGGGAGCTTACAGTGG + Intergenic
1068422961 10:56820714-56820736 GGTGCCTGGAGACCATGCAGAGG + Intergenic
1070592019 10:77808122-77808144 GGTGTCCAGGGAGCATGCACAGG - Intronic
1070759183 10:79012831-79012853 GGTTCCTGGTGTGCATGCACTGG - Intergenic
1070987777 10:80702994-80703016 GGTCCCTGAGGAGCCTGGAGGGG + Intergenic
1072189699 10:93069571-93069593 GCTCCCTGGGGGGAAGGCACTGG + Intergenic
1074509421 10:114099311-114099333 GGTCCCTGGGAAGCAGGGAAAGG - Intergenic
1074877216 10:117622773-117622795 GGCCCCTGGGGAGCAGGTATTGG - Intergenic
1075732349 10:124644070-124644092 GGTGCCCTGGGAGCAGGCACCGG - Intronic
1076887158 10:133268114-133268136 CGTTCCTGGGGAGGAAGCACAGG + Exonic
1077232569 11:1464603-1464625 GCTCCATGGGGAGCCTGCCCTGG + Intergenic
1079182465 11:18205314-18205336 GGCCCCTGGGTGGCATACACAGG - Intronic
1079365733 11:19807669-19807691 GGTCACTGGGGAGCCTGCAGTGG - Intronic
1083198817 11:61107144-61107166 GGTACCTGGGGAGGATTCAGCGG + Intronic
1086578515 11:88368975-88368997 GGTCCATGGGGATCAGGCATAGG - Intergenic
1087366455 11:97225924-97225946 GGCCCTTGCGGAGCATGAACTGG + Intergenic
1089121178 11:116136663-116136685 GGTCCCTGGGAAGCAGGAAAGGG + Intergenic
1089773605 11:120820635-120820657 GGTGCCTGGGGCTCAGGCACTGG - Intronic
1090274361 11:125409220-125409242 GCTTTCTGGGGAGCCTGCACTGG - Intronic
1091668156 12:2434065-2434087 GGTCCCGGGGGATGCTGCACTGG + Intronic
1091690810 12:2596252-2596274 GCTTCCTGGGGAACATCCACAGG - Intronic
1091753203 12:3035349-3035371 GCTGCCTGGGAAGGATGCACTGG - Intronic
1094052993 12:26240791-26240813 CATCCCTGGGCAGCATGCAGAGG + Intronic
1094169718 12:27479299-27479321 GGCCCCTGGGTGGTATGCACAGG + Intronic
1094169886 12:27480367-27480389 GGCCCCTGGGTGGCATGCACAGG + Intronic
1094813229 12:34162093-34162115 TGTCCTAGGGGAGCAAGCACAGG - Intergenic
1096789645 12:54036874-54036896 GTCCCCTGGGGAGGAAGCACAGG - Intronic
1101999827 12:109550421-109550443 GGTGCCTTGGGAGCTTGCACTGG + Intergenic
1102456181 12:113072054-113072076 GGTCCCTGGGGAGGACCCTCAGG - Intronic
1103847227 12:123909855-123909877 GGTCCCTGGGGAGTGGGCATGGG + Intronic
1106022249 13:25926484-25926506 GGACTCTGGGGAGCAGGAACTGG + Intronic
1106357028 13:28992665-28992687 GGGCCCAGGGGAGCATGCGAGGG - Intronic
1108868987 13:54958949-54958971 GGCCCCTGGGCAGCATCTACGGG - Intergenic
1110871080 13:80452724-80452746 AGTCCCTGGGGAACATGCACAGG - Intergenic
1113038116 13:106073655-106073677 AGTCCCTGGAGAGGATGGACTGG + Intergenic
1113634998 13:111913358-111913380 GGGCCCTGGGAAGAGTGCACAGG + Intergenic
1114567525 14:23643611-23643633 GGTCCCTGGAGACCAAGCGCAGG - Intronic
1118183107 14:63513243-63513265 GGCCCCTCAGGATCATGCACTGG + Intronic
1119544246 14:75460270-75460292 GGACCCTGGGGAACAAGCAAGGG - Intronic
1121208556 14:92189233-92189255 GGTGCCTGGGGAGGAAGCTCTGG + Intergenic
1121465660 14:94113985-94114007 AGCCCCTGGGGAGCAGGCAGAGG - Intronic
1121619102 14:95333808-95333830 GGTCCCAGGGGAGAAGGCAGGGG + Intergenic
1121977913 14:98422913-98422935 GGGGCCTGGAGAGCATGCTCAGG - Intergenic
1122932189 14:104939103-104939125 GGTCCCTGGGGAGCAGCCTGTGG - Exonic
1122960535 14:105091944-105091966 GGCACCTGGGGAGCAGGCCCAGG - Intergenic
1126480315 15:49111261-49111283 GGCCCCAGGACAGCATGCACTGG - Intronic
1127047537 15:55043106-55043128 GGTTCCCAGGCAGCATGCACTGG + Intergenic
1127500426 15:59549434-59549456 GTTACCTGGGGAGCATGCTTTGG + Intergenic
1127822238 15:62668622-62668644 GGGCACTGGGGACCATGCTCTGG - Intronic
1128706784 15:69842564-69842586 GCTCCCTGGGAAGCTGGCACAGG - Intergenic
1129051228 15:72783543-72783565 GGTCCCGGGGGCGCAGGCGCGGG + Exonic
1129270509 15:74417074-74417096 GGCTCCTGGGGACCCTGCACTGG + Intronic
1132155989 15:99495544-99495566 AGGCCCAGGGGAGCATCCACAGG + Intergenic
1132347067 15:101114750-101114772 GGTCCTTGGTGAGCATGCACTGG - Intergenic
1132679558 16:1134178-1134200 GGTCCCTGGGGTGTTTGCTCTGG - Intergenic
1135296439 16:21283643-21283665 GGGCTCTTGGGAGCATGCGCGGG + Intronic
1137290480 16:47049082-47049104 GGTCCCTGGGAAGCATGACGTGG + Intergenic
1137751031 16:50861236-50861258 GGCCTCTGGGGAGCAGGCATGGG - Intergenic
1138460416 16:57144396-57144418 GTTCCCTGGGGAGGTTGCAGAGG - Intronic
1139010658 16:62629025-62629047 GGTTCATGGGGTACATGCACAGG + Intergenic
1140821882 16:78670333-78670355 GGTCACTGGGGAGCTTGGAAAGG - Intronic
1142222669 16:88863297-88863319 TGTCCATGGGGGGAATGCACAGG + Intergenic
1142699074 17:1648811-1648833 GTTCCCTGGGGCGCCTGCGCCGG + Exonic
1142996518 17:3763829-3763851 GGGTCCTGGGGAGCATTCCCTGG + Intronic
1143904811 17:10199515-10199537 GGTCCCTGGAGAGCAGGGACTGG - Intergenic
1144614549 17:16757216-16757238 GATCCCTTGGTAGCATGCATGGG + Intronic
1144898156 17:18558458-18558480 GATCCCTTGGTAGCATGCATGGG - Intergenic
1145134214 17:20387256-20387278 GATCCCTTGGTAGCATGCATGGG + Intergenic
1147650352 17:42058472-42058494 GCTCCCTGGGGAAAATGCAGAGG - Intronic
1147897396 17:43759513-43759535 GATCCCTGAGGAGCATGAGCTGG - Intergenic
1149993161 17:61393944-61393966 AGGCCATGGGCAGCATGCACAGG - Intergenic
1150284981 17:63949435-63949457 GGACCCTGAGGAGCAGGCAGAGG - Exonic
1151561285 17:74871183-74871205 GTTGCCTGGGAAGCATGCACGGG + Intronic
1152189810 17:78881493-78881515 GGCCCCTGGGATGCATGCAGTGG - Intronic
1152386948 17:79980418-79980440 GTTCCCAGGGGAACATGCAGTGG + Intronic
1152874588 17:82779483-82779505 TGTCCCTGTGGAGCATGCTTAGG - Intronic
1152956264 18:44665-44687 TGTCCTAGGGGAGCAAGCACAGG - Intergenic
1153752317 18:8245344-8245366 TGGCCCAGTGGAGCATGCACAGG + Intronic
1155761516 18:29574621-29574643 GGTCCCAGGTGAGCCTGTACTGG + Intergenic
1157571556 18:48715717-48715739 GCTCCCTGGGAAGCAGGCTCTGG + Intronic
1158553538 18:58457418-58457440 GGACCCTGTGGAAAATGCACAGG + Intergenic
1160549896 18:79687696-79687718 GTTCACTGGTGGGCATGCACCGG + Intronic
1160610031 18:80077702-80077724 GTTCCCTGGGGGGCATGGACAGG + Intronic
1161196129 19:2987640-2987662 GATTCCTGGGCAGCTTGCACAGG - Intronic
1161268153 19:3374760-3374782 GGTCCCTGGGGAAGAGGCCCTGG + Intronic
1161467128 19:4437227-4437249 CGTCCCTGGGGAGCAGGGTCTGG + Intronic
1161854196 19:6754229-6754251 GGTTCGTGGGGAGCAGGGACTGG - Exonic
1162158702 19:8696732-8696754 GGTCCCTGAGGAGCATACTAAGG + Intergenic
1162479806 19:10921597-10921619 GGACCCTGTGGAGCAGGCAATGG - Exonic
1163509278 19:17725714-17725736 GGGCCCTGAGGAGCAGGCCCTGG + Intronic
1163820939 19:19496263-19496285 GGTCCAAGGGGAGCAGTCACAGG - Intronic
1165388398 19:35524977-35524999 GGTCCCTGGGGAAAAGGAACTGG - Intronic
1165423245 19:35732581-35732603 GGGCCATGGGGAGCAGCCACGGG + Exonic
1166749189 19:45156636-45156658 GGGCCCTGGGGACCAGGCACTGG + Intronic
1167338363 19:48900440-48900462 GGTCCCGGAGGAGGATGCACTGG + Intronic
1167673507 19:50870311-50870333 GGTCCCTGGGAAGCAAGGACTGG + Intronic
1168104852 19:54160420-54160442 GGCCCCTGGGGAACATGGAAAGG - Intronic
1168270194 19:55245674-55245696 GGTACCTGGGAGGCAAGCACAGG + Exonic
1168475738 19:56673712-56673734 GGTCCCTGGGTAGGATGGAGTGG + Intergenic
925832226 2:7907184-7907206 GGTCGCTGCGGAGAATTCACTGG - Intergenic
926742736 2:16125936-16125958 GGTCCCTGTGGTGGAGGCACAGG - Intergenic
927080625 2:19626193-19626215 GGTCCCTGAGCAGCATGCATGGG - Intergenic
932572737 2:72946434-72946456 GGACCCCGAGGAGCATGCAGTGG - Intronic
933648166 2:84828831-84828853 GGTTCCTTGGGGTCATGCACAGG + Intronic
936785923 2:116094352-116094374 GGTCCCTGGGTGGCATGCTCAGG + Intergenic
937030958 2:118739963-118739985 GGTCCCTGGAGAGCATGCAGGGG + Intergenic
937310740 2:120901532-120901554 GGCCACTGGGGAGCATGAACAGG + Intronic
937895831 2:126976368-126976390 TGTGCCTGGGGAGCCTGCAGAGG - Intergenic
938960411 2:136335691-136335713 GGTTCCTGAGGGGCATGCCCAGG + Intergenic
946183512 2:217963387-217963409 GGTCACTGGCTATCATGCACCGG + Intronic
948406328 2:237722801-237722823 GGGCCCTGAGCAGCAGGCACTGG - Intronic
948890136 2:240903458-240903480 AGGCCTTGGGGGGCATGCACGGG + Intergenic
1171364632 20:24615540-24615562 GGTCCATGGGGAGGATGAAGTGG - Intronic
1171511208 20:25686136-25686158 TGTCCCTGGTGAGCATGCCTGGG - Intronic
1173365266 20:42379493-42379515 AGGCTCTGGGAAGCATGCACTGG - Intronic
1173886590 20:46464568-46464590 GGTCTCTGGGCAGCATCCATTGG + Intergenic
1174039819 20:47691172-47691194 AGTCCCTGGGGTGCCTACACTGG + Intronic
1175862352 20:62157128-62157150 AGGCCGTGGGGAGCAGGCACAGG - Intronic
1179881112 21:44293698-44293720 GGTCCCAGGGGAGAGCGCACAGG + Intronic
1180042722 21:45288294-45288316 GGTCCGTGGGGAGGAGGCCCGGG + Intergenic
1180786038 22:18548347-18548369 GGGCCAAGGGGAGCATGAACCGG - Intergenic
1181131320 22:20734072-20734094 GGGCCAAGGGGAGCATGAACCGG - Exonic
1181236417 22:21450176-21450198 GGTCCGGCGGGAGCATGCAGTGG - Exonic
1181242961 22:21487901-21487923 GGGCCAAGGGGAGCATGAACCGG - Intergenic
1181924220 22:26345207-26345229 GGTCCCTGGGGTACAGGCCCTGG + Intronic
1183964683 22:41434633-41434655 GGTCCCTGGGTAGGATGGAGTGG + Exonic
1184381166 22:44145625-44145647 GGGCACTGGGGACCAGGCACAGG - Intronic
1185012122 22:48320078-48320100 GGTTCCTGGGCACCATCCACGGG + Intergenic
949655218 3:6210125-6210147 GATCAGTGGGGAGCATACACTGG - Intergenic
953108135 3:39905988-39906010 GGATCCTGGGGAGCGTGCAGAGG + Intronic
954718525 3:52539496-52539518 GGTATCTGGGGAGAAGGCACAGG + Intronic
955425019 3:58778688-58778710 GGCCCCAGGGCAGCATACACTGG - Intronic
962119919 3:132550517-132550539 GATGCCTGTGGAGGATGCACAGG - Intergenic
962839555 3:139221538-139221560 GGTCCCTGGGGGGCTTGGAAAGG + Intronic
963054544 3:141174960-141174982 GCTCCCTGGGAGGCAGGCACAGG - Intergenic
966433117 3:179853554-179853576 GGTCCCTAGGAAGGATGCACAGG - Intronic
968358073 3:198123576-198123598 TGTCCTAGGGGAGCAAGCACAGG + Intergenic
968704729 4:2072622-2072644 GGACCCTGAGGGGCAAGCACAGG - Intronic
969169539 4:5348821-5348843 GGTCCCTTGGCTGCATGCTCAGG - Intronic
969223061 4:5773894-5773916 GGTCCCTGGGGAACATTCTTGGG + Intronic
969605442 4:8200041-8200063 GGCTCCTGGGGATCACGCACAGG - Intronic
972251592 4:37308554-37308576 GGTCCCTGGGGAGCATGCACAGG + Intronic
980086534 4:128396454-128396476 GGTTCATGGGGTACATGCACAGG + Intergenic
983768946 4:171523752-171523774 TGCCCCTGGGGAGCAGGAACTGG + Intergenic
984179712 4:176467143-176467165 GGTCCCTGGCGAGCATCCCACGG - Intergenic
985873861 5:2580382-2580404 GGACCCTGGAGAGCCTTCACTGG - Intergenic
986062661 5:4206415-4206437 GGTCCCTGGGGTGCATCCCTGGG - Intergenic
987570233 5:19647643-19647665 GCTCCCTGTGGAGCTTACACAGG + Intronic
994626717 5:102229403-102229425 GGTCCCTGGGAATCAAACACAGG - Intergenic
1000244377 5:159437093-159437115 GGTCCCTGAGGAGCAGGGATAGG + Intergenic
1001810837 5:174627016-174627038 GGCCCCTGTGGATCATGCTCAGG + Intergenic
1002599601 5:180346657-180346679 GGCCCCAGGGGCGCACGCACTGG - Intronic
1002911925 6:1497284-1497306 GGCCCTGGGGTAGCATGCACAGG - Intergenic
1003635253 6:7826090-7826112 GGTCCCCCAGGAGCATGCAGTGG + Intronic
1003962778 6:11224465-11224487 TGCCCCAGGGGAGCATGCAAGGG + Intronic
1004635663 6:17465388-17465410 GTTCCCAGGGAGGCATGCACTGG + Intronic
1004726276 6:18314035-18314057 GCTCCCTGGGAAGGATGCACAGG - Intergenic
1005798166 6:29390628-29390650 GGCCCCAGGGCAGCATACACTGG + Intronic
1006907391 6:37541988-37542010 GGTCCCTGGGGGGGAGGCCCAGG + Intergenic
1007776168 6:44225635-44225657 AGTGCCTGGCTAGCATGCACAGG + Intronic
1009985693 6:70778979-70779001 GGTCCCTGGGCAGCATGTGCAGG + Intronic
1012654358 6:101795747-101795769 GGTCCCTGGGTGGCATGCTTGGG + Intronic
1015430853 6:133129200-133129222 GGTCCCTGGAGACCATGGCCTGG - Intergenic
1016425835 6:143934974-143934996 GGTTCCTGGGTGGCATGCATGGG + Intronic
1017989115 6:159470927-159470949 AGTCCTTGGAGAGCATCCACAGG - Intergenic
1018374859 6:163201458-163201480 GGCCCCTGGGGAGCCTGCTCAGG + Intronic
1018530630 6:164759196-164759218 GGTCCCCAGGGAGCATTCAGTGG - Intergenic
1019448906 7:1086112-1086134 GTTTCCTGGGGAGCCTGCCCTGG - Intronic
1019514470 7:1433679-1433701 GGGCCCTGGGGAGCTTGTGCTGG - Intronic
1019574782 7:1732128-1732150 GGTCACAGCGGAGCAAGCACAGG + Intronic
1020491833 7:8795322-8795344 GGTCTCTGCGGAGCATGTCCCGG - Intergenic
1022097093 7:27147910-27147932 GGTCCCCGGGGAGCGGGCTCCGG - Intronic
1023844116 7:44111608-44111630 CAACCCTGGGGAGCATGAACTGG + Exonic
1024629825 7:51237991-51238013 GGTACCTGAGGGGCATGCCCTGG - Intronic
1024866470 7:53909435-53909457 GCTGCCTGTGGAGCATGCAGGGG + Intergenic
1025977115 7:66378143-66378165 GGCCCCTGGGCAGCATGATCTGG + Intronic
1026037487 7:66840113-66840135 GGTCCCTGGAGATAAAGCACAGG - Intergenic
1028645062 7:93086720-93086742 GGCCCCTGGGTAGCATGTTCAGG + Intergenic
1028964680 7:96789142-96789164 GGAGCCTGGGGAGCATGGAGTGG + Intergenic
1029699793 7:102238825-102238847 GGTCCTTGGTGAGCATGTGCTGG + Intronic
1032220499 7:129990643-129990665 GGTGCCTTGGGAGCATGTTCAGG + Intergenic
1033643416 7:143283937-143283959 TGTCCCTGGGGAGCCTGGATTGG + Intronic
1034843040 7:154417474-154417496 GGTGCCTAGGGAGCCTTCACAGG - Intronic
1035201991 7:157273598-157273620 GGTGCCTGGGCGGCCTGCACCGG - Intergenic
1035299491 7:157887750-157887772 GGTACTGGGGGAGCAGGCACTGG - Intronic
1035444406 7:158929992-158930014 GGTCTCCGGGCAGAATGCACAGG - Intronic
1035625115 8:1065899-1065921 GGTCTGTGGGGAGAATGCTCTGG + Intergenic
1036955876 8:13187820-13187842 AATCCCTGGGGAGCAGTCACAGG - Intronic
1040688123 8:49901246-49901268 GGTCTCTGGAATGCATGCACAGG - Intergenic
1041021902 8:53646435-53646457 GCACGGTGGGGAGCATGCACAGG + Intergenic
1041782819 8:61596217-61596239 GGCCCCTGGAAGGCATGCACAGG - Intronic
1042193154 8:66208578-66208600 GGCCACTGGGGAGCATGTATAGG - Intergenic
1043314618 8:78904888-78904910 AGACCCTGGTGAGCATGCTCTGG - Intergenic
1043836974 8:85059871-85059893 GGTCCCTGAGAGGCATGCACAGG + Intergenic
1046080127 8:109361851-109361873 AGCCCCTGGGGAGCATTCAGTGG + Intergenic
1047325084 8:123828307-123828329 GGTCCCTGGTGAGGATGCTGTGG + Intergenic
1048333171 8:133484892-133484914 GCTCCCTGGGTATCACGCACTGG + Intronic
1051879940 9:21829550-21829572 AGTCCCTGGAGAGAATACACGGG - Intronic
1053008733 9:34621513-34621535 GGACCCTGGGAAGCTGGCACAGG + Exonic
1055052691 9:71995951-71995973 GGTCTTTGGGAAGCATCCACAGG + Intergenic
1056281417 9:85044690-85044712 GCTCCCTGGGAAGCAGACACCGG + Intergenic
1057192217 9:93094542-93094564 GCCTCCTGGGGAGCATGGACGGG + Intergenic
1057353530 9:94318557-94318579 GGTCTCTGGGGAGCAATCCCTGG - Exonic
1057654221 9:96939035-96939057 GGTCTCTGGGGAGCAATCCCTGG + Exonic
1058911044 9:109520244-109520266 GTTCCCTGGGGAAAATGCAATGG - Intergenic
1059503980 9:114781347-114781369 GTTCCCTGGGGTAGATGCACAGG + Intergenic
1059597727 9:115740983-115741005 CATCCCTGGGCAGCATTCACTGG - Intergenic
1060484969 9:124041066-124041088 GGTCCCGGGGGAGCCGGCCCGGG + Intergenic
1060788447 9:126468778-126468800 GGTCCCTGGGGAGCCACCAAAGG - Intronic
1061025972 9:128049882-128049904 GATCACTGGGGTGTATGCACGGG - Intergenic
1062085016 9:134643869-134643891 ACTGCCTGGGGACCATGCACCGG + Intronic
1062341238 9:136094811-136094833 GGTCCCTGGGGAGGCCGCGCGGG + Intronic
1062718013 9:138020888-138020910 GGACCATGGGGAACATGCAGAGG - Intronic
1062741940 9:138180111-138180133 TGTCCTAGGGGAGCAAGCACAGG + Intergenic
1189292513 X:39896156-39896178 GGTGTCTGGGGAGGATGCAATGG + Intergenic
1192435729 X:71142485-71142507 GGTCTCTTGGGAGAATGCAGGGG + Intergenic
1192728465 X:73777967-73777989 GGTCCCTGGGCAGGAAGGACAGG + Intergenic
1194461636 X:94176898-94176920 GGTCCATTTGGAGCATGGACTGG - Intergenic
1195112019 X:101658705-101658727 AGTGCCTGGGGAGCCTGCGCAGG - Intronic
1195687916 X:107602290-107602312 CCTCCCTGGGCAGCATGCCCAGG - Exonic
1202199502 Y:22331569-22331591 GCACCCTGGAGAGGATGCACAGG + Intronic