ID: 972256266

View in Genome Browser
Species Human (GRCh38)
Location 4:37358976-37358998
Sequence TTCCCAGGACACTCCCATAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 109}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972256266_972256270 24 Left 972256266 4:37358976-37358998 CCACTATGGGAGTGTCCTGGGAA 0: 1
1: 0
2: 1
3: 13
4: 109
Right 972256270 4:37359023-37359045 GCTTTACCGTAATCCAGCCTTGG 0: 1
1: 0
2: 1
3: 64
4: 1675

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972256266 Original CRISPR TTCCCAGGACACTCCCATAG TGG (reversed) Intronic
901476719 1:9495081-9495103 CTCCCAGGACACACCCCAAGCGG - Intergenic
904253050 1:29237995-29238017 CTCCCGGGACACTCCCTTGGTGG + Intronic
905470829 1:38190506-38190528 TACCCAGCACACTTCCACAGGGG + Intergenic
906824434 1:48963583-48963605 TTCCTGGGGAACTCCCATAGGGG + Intronic
910301787 1:85714214-85714236 TTCCCATGACACTGCTATCGGGG + Intergenic
913568875 1:120100740-120100762 CTCCCAGGGCACTCCTATACTGG + Intergenic
914550728 1:148712514-148712536 CTCCCAGGGCACTCCTATACTGG + Intergenic
916479114 1:165199377-165199399 TTCCCAGAACCCTCCCCTGGAGG + Intergenic
919411253 1:197245997-197246019 CTCCTATGACACTACCATAGTGG + Intergenic
920990864 1:210938020-210938042 TTCCAGGGACATTCCCATAGAGG - Intronic
921888081 1:220326413-220326435 TTCCCAGAATAGTCCCATTGTGG + Intergenic
921913306 1:220576479-220576501 TTTCCAGGACCCTCCCACTGAGG - Intronic
1062838923 10:654598-654620 TTCACAGAACACTACCAAAGAGG + Intronic
1063560286 10:7119810-7119832 TTCCCATGACAATGCTATAGGGG - Intergenic
1065307084 10:24379529-24379551 CTCTCAGGACCTTCCCATAGAGG - Intronic
1068046459 10:51892488-51892510 TGCCCAGGACACTCCTATGATGG - Intronic
1069835443 10:71305069-71305091 TCCCCACCCCACTCCCATAGAGG + Intergenic
1078519867 11:12054080-12054102 TTCACAGGGCACACCCAGAGGGG - Intergenic
1079139383 11:17797917-17797939 CCCCCAGGACAGTCCCACAGTGG + Intronic
1080634688 11:34113405-34113427 TTCCCAGGATACACACACAGGGG - Intronic
1083272617 11:61580048-61580070 CTCCCAGGCCACTCCCCTGGCGG + Intronic
1083526595 11:63372065-63372087 TTCCCAGGACAGTATCACAGAGG - Intronic
1084673738 11:70622417-70622439 AGCCCAGGACACTCGCACAGAGG - Intronic
1086466073 11:87054686-87054708 TTTCAAGGAAACTCCCAAAGTGG - Intronic
1088903595 11:114137364-114137386 TTCCCAAGACACTTCCATTTTGG - Intronic
1089333354 11:117705543-117705565 ATTCCAGGCCACTCCCACAGTGG - Intronic
1091400788 12:179443-179465 GCCCCAGGACACTCGCAGAGAGG + Intergenic
1094693070 12:32788643-32788665 TTCACAGGGGACTCCCAGAGAGG + Intergenic
1095154154 12:38832530-38832552 TTCCCAGGCCTCTCCCTTAAAGG + Intronic
1098361443 12:69658088-69658110 TTCCCAGAACACATCCAGAGTGG - Intronic
1098990499 12:77060221-77060243 TTCACAGGACACTCTAATGGAGG - Intronic
1101825902 12:108219757-108219779 TACCCAGGACAACCCCAAAGGGG + Intronic
1102063359 12:109952256-109952278 CCCCCAGGACACACCCACAGAGG - Intronic
1103024680 12:117563905-117563927 ATCCCAGGCCACACCAATAGAGG - Intronic
1113625393 13:111792322-111792344 TTCCCAGGTCTCTCTCATAGGGG + Intergenic
1114345548 14:21790660-21790682 TCCCCAGGACAGTCTCATAGAGG + Intergenic
1115715501 14:36098674-36098696 TTCACAGTACAGTCCCATATGGG - Intergenic
1116867016 14:50039595-50039617 TTTCCAGGACTCTCCCTGAGAGG + Intergenic
1126446942 15:48757885-48757907 TTCCCAGGTGACTCGGATAGAGG + Intronic
1133370831 16:5244455-5244477 TACCCAGTTCACTCCCATACTGG + Intergenic
1137550023 16:49431183-49431205 TTACCAGCACCCTCCCATGGCGG + Intergenic
1137690237 16:50421280-50421302 TTCCCAGGTAACTGCCATACCGG + Intergenic
1139713023 16:68790908-68790930 TTTCCAGGCCTCTCCCAGAGAGG - Intronic
1140907233 16:79419227-79419249 CTCCCAGCAGCCTCCCATAGAGG + Intergenic
1144154705 17:12488105-12488127 TTCCCAGGAGATTCTCATAAAGG - Intergenic
1144654277 17:17025378-17025400 GTCCCAGGAAACACCAATAGAGG + Intergenic
1147316515 17:39623440-39623462 GTCCCAGGAAACACCCTTAGAGG - Intergenic
1151358968 17:73577055-73577077 TAGCCTGGACCCTCCCATAGGGG - Intronic
1157943529 18:51954794-51954816 CTCCCAGGAGACTCCCAGAATGG - Intergenic
1158750055 18:60248212-60248234 AACCCAGGGCACTCCCATAGGGG - Intergenic
926549146 2:14280017-14280039 TTTCCAGGAGACTCCTATAGGGG - Intergenic
926730768 2:16034064-16034086 TTACCAGGCCACTCACACAGAGG + Intergenic
931633625 2:64322808-64322830 TTCCCAGGAAGCTCCCTCAGGGG - Intergenic
932873258 2:75425158-75425180 GTCACAAGCCACTCCCATAGTGG + Intergenic
933351490 2:81157820-81157842 TTACCACGAGAATCCCATAGAGG - Intergenic
934947367 2:98551563-98551585 TTCCCAGGGAAGTCCCAAAGTGG - Intronic
937288842 2:120769800-120769822 TTCCCAACACACTCCCAAACAGG - Intronic
942314996 2:174689902-174689924 TTCCCAGGAAAGTCCCATTAGGG - Intergenic
943944346 2:194039983-194040005 TTCCCAGGAAATTCACCTAGAGG - Intergenic
945657123 2:212638208-212638230 TCCCCAGGAAACTTCCATACCGG + Intergenic
946625021 2:221602176-221602198 TTCCTAAGACCCTCCCACAGAGG + Intergenic
947318592 2:228892382-228892404 TGCACAGCACACTCCCATTGAGG - Intronic
947705055 2:232267922-232267944 TTCCCAAGACACTTTCATAATGG - Intronic
1172205547 20:33160447-33160469 TTCCCAGGAGCCTCCCATAGTGG - Intergenic
1174664076 20:52240851-52240873 ATCCCAGGAAACACCCATAAAGG + Intergenic
1179106446 21:38404732-38404754 TTCCCGGGACAAGCCCTTAGGGG + Intronic
1180439988 22:15355712-15355734 ATTCCAGGACACTACCATAAGGG - Intergenic
1181850734 22:25748224-25748246 TCCCCAGGACAGTCACACAGTGG - Intronic
1182700954 22:32237879-32237901 TTCTCATGACACTCTCATAAAGG - Intronic
1183277000 22:36904809-36904831 TTCCCAGGTAAGACCCATAGAGG + Intergenic
1185097273 22:48817619-48817641 TTCCCAGGAAGGACCCATAGGGG + Intronic
951926731 3:27915998-27916020 TCCCAAAGACACTCCCATAAAGG + Intergenic
953370160 3:42380781-42380803 TTCCCACCACACTTCCATGGGGG + Intergenic
955660387 3:61292684-61292706 TCCTAAGGACACTGCCATAGTGG - Intergenic
955905799 3:63806326-63806348 ATCCCAGGAAACACCCAGAGTGG - Intergenic
960875633 3:122292535-122292557 TTGCCAGAACACCCTCATAGGGG - Intergenic
962405422 3:135095891-135095913 TTCCCAAGGCTCTCCCAGAGTGG + Intronic
962852628 3:139319302-139319324 TTCCCAGGACAAAGCCATTGAGG - Intronic
966389632 3:179438409-179438431 TTCCCAAAACAATCCCATAGGGG - Intronic
969216259 4:5724639-5724661 TTCCAAGGACCCTGCCACAGAGG - Intronic
970349118 4:15183384-15183406 TTCCCAGGCCACTCACATGGGGG + Intergenic
972256266 4:37358976-37358998 TTCCCAGGACACTCCCATAGTGG - Intronic
980886915 4:138772798-138772820 TTCCCAGGACACTTCTATGTTGG - Intergenic
985918419 5:2946228-2946250 TTCCCAGGAAGCTCCGATAAAGG + Intergenic
989734740 5:44690310-44690332 TTCTCACAACACTCCTATAGAGG + Intergenic
990358227 5:54991675-54991697 TTCCCAGGACACTCTCATGCAGG - Intronic
990647716 5:57863363-57863385 TTCACAGGAAACTCTCATATTGG + Intergenic
990907241 5:60817510-60817532 TTGCCAAATCACTCCCATAGAGG - Intronic
995660265 5:114474500-114474522 TTCCCTGCACACTCTCATACAGG - Intronic
999126614 5:149250685-149250707 TTCCCAAGCCCCTCCCATGGGGG - Intronic
999842844 5:155448014-155448036 TTCCCAGGAATCTTCCAAAGGGG - Intergenic
1001677822 5:173533074-173533096 TGCCCAGGACTATCCCGTAGCGG - Intergenic
1006413694 6:33891107-33891129 TTCCAAGCACACTCCCATTTGGG + Intergenic
1007682824 6:43645916-43645938 TTCCCTGGTCACTACCATACAGG + Intronic
1017376020 6:153769029-153769051 TTTCCATGACACTCCAATAAGGG + Intergenic
1021249446 7:18306042-18306064 ATCCCAGGAAACTCCAATAGGGG + Intronic
1026225465 7:68436413-68436435 TTCACATGACAGTCCCATACGGG - Intergenic
1026670211 7:72383651-72383673 TTCCCAGAACACTTCCTTAGAGG - Intronic
1029440200 7:100583130-100583152 TTCCCAGGTCCCTCCCATCTGGG + Intronic
1029918126 7:104232818-104232840 TTCCAGAGACTCTCCCATAGGGG + Intergenic
1030908738 7:115220077-115220099 TTCCAAGGACACTCAACTAGTGG + Intergenic
1031233615 7:119143189-119143211 TCCCCATGACTCTCCCATACTGG - Intergenic
1034479879 7:151311416-151311438 TTCCCAGGACAGTGCCCTAGTGG + Intergenic
1034584397 7:152076387-152076409 ATCCCAGGACACACCAGTAGGGG + Intronic
1037291094 8:17350142-17350164 ATCCCAGGACACTTCCATGTGGG - Intronic
1039279545 8:35968713-35968735 TCCTCAGCACACTCCCACAGAGG - Intergenic
1041853916 8:62426966-62426988 ATCACAGGACACTCCCATGCTGG + Intronic
1044089077 8:87977096-87977118 TTCCCATTACACTCTCTTAGAGG - Intergenic
1047468440 8:125143069-125143091 CTCCCAGGACACCCCCAGTGTGG + Intronic
1048503882 8:135003392-135003414 TTCCCAGGACACTCCTATGAGGG - Intergenic
1049387780 8:142353071-142353093 CTCCCAGGACACTCTCATTCAGG + Intronic
1049989881 9:980876-980898 GTCCGAGGACACTCCCCTGGAGG - Intronic
1056658249 9:88526351-88526373 CTCCTAGGAAACCCCCATAGGGG + Intergenic
1058544907 9:106050916-106050938 ATCCCAGGAAATTCCAATAGGGG - Intergenic
1061121725 9:128647374-128647396 TTCCTAGGCCACTCTCAGAGGGG + Intronic
1061243011 9:129385172-129385194 TTCCCAGGACACTCCCTTTTGGG - Intergenic
1061866710 9:133495044-133495066 TCCCCAGGACCCTTCCATGGAGG + Intergenic
1061956127 9:133962141-133962163 TGCCCAGGAGGGTCCCATAGAGG - Intronic
1186416457 X:9386998-9387020 ATCCCAGGAGACACCCATAAGGG - Intergenic
1186654763 X:11600778-11600800 TTCCCAGGAAACACCAGTAGGGG + Intronic
1188578780 X:31685307-31685329 ATCCCAGGACATTCACATATAGG + Intronic
1197262716 X:124334426-124334448 GCCCCAGGACACTCCCCTGGGGG + Intronic
1197262765 X:124334612-124334634 GCCCCAGGACACTCCCCTGGGGG + Intronic
1198870056 X:141168850-141168872 TTCCAGGAACACTGCCATAGAGG + Intergenic