ID: 972256270

View in Genome Browser
Species Human (GRCh38)
Location 4:37359023-37359045
Sequence GCTTTACCGTAATCCAGCCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1741
Summary {0: 1, 1: 0, 2: 1, 3: 64, 4: 1675}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972256265_972256270 25 Left 972256265 4:37358975-37358997 CCCACTATGGGAGTGTCCTGGGA 0: 1
1: 0
2: 0
3: 8
4: 116
Right 972256270 4:37359023-37359045 GCTTTACCGTAATCCAGCCTTGG 0: 1
1: 0
2: 1
3: 64
4: 1675
972256267_972256270 9 Left 972256267 4:37358991-37359013 CCTGGGAAACCTCAATTACTGTG 0: 1
1: 0
2: 1
3: 13
4: 152
Right 972256270 4:37359023-37359045 GCTTTACCGTAATCCAGCCTTGG 0: 1
1: 0
2: 1
3: 64
4: 1675
972256266_972256270 24 Left 972256266 4:37358976-37358998 CCACTATGGGAGTGTCCTGGGAA 0: 1
1: 0
2: 1
3: 13
4: 109
Right 972256270 4:37359023-37359045 GCTTTACCGTAATCCAGCCTTGG 0: 1
1: 0
2: 1
3: 64
4: 1675
972256268_972256270 0 Left 972256268 4:37359000-37359022 CCTCAATTACTGTGATCTCCACA 0: 1
1: 0
2: 1
3: 16
4: 163
Right 972256270 4:37359023-37359045 GCTTTACCGTAATCCAGCCTTGG 0: 1
1: 0
2: 1
3: 64
4: 1675

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972256270 Original CRISPR GCTTTACCGTAATCCAGCCT TGG Intronic
900111900 1:1010788-1010810 GCTTCACTGCACTCCAGCCTGGG - Intergenic
900469310 1:2845183-2845205 GCATTACTGCACTCCAGCCTGGG + Intergenic
900661444 1:3786455-3786477 GCGCCACCGTACTCCAGCCTGGG + Intronic
900694925 1:4003875-4003897 GCTCCACTGTACTCCAGCCTGGG + Intergenic
901015627 1:6228383-6228405 GCGCCACCGTACTCCAGCCTGGG - Intronic
901040754 1:6361760-6361782 GCGTTACTGCATTCCAGCCTGGG + Intronic
901152283 1:7111840-7111862 GCATTACTGCACTCCAGCCTGGG + Intronic
901340039 1:8489315-8489337 ACTCTACTGTACTCCAGCCTTGG + Intronic
902305536 1:15535802-15535824 GCATCACTGTACTCCAGCCTGGG - Intronic
902307361 1:15551986-15552008 GTTTCACTGTACTCCAGCCTGGG + Intronic
902448525 1:16482912-16482934 GCGTCACTGTACTCCAGCCTGGG + Intergenic
902509313 1:16957362-16957384 GCATCACCGCACTCCAGCCTGGG + Intronic
902755489 1:18546638-18546660 GCACTACTGTACTCCAGCCTGGG + Intergenic
903072531 1:20733487-20733509 GCTGTACTGCACTCCAGCCTGGG - Intergenic
903244908 1:22008191-22008213 GCATTACTGCACTCCAGCCTGGG - Intronic
903320823 1:22542228-22542250 GCACCACCGTACTCCAGCCTGGG + Intergenic
903561176 1:24229211-24229233 GCACTACCGCACTCCAGCCTGGG - Intergenic
903591138 1:24456803-24456825 GCTCTACTGCACTCCAGCCTAGG - Intronic
903696256 1:25209517-25209539 GCGTCACTGTACTCCAGCCTGGG + Intergenic
903770814 1:25763223-25763245 GCGCTACCGCACTCCAGCCTGGG + Intronic
904129175 1:28262883-28262905 GCTTCACTGTACTCCAGCCTGGG + Intronic
904197334 1:28795559-28795581 GCGCCACCGTACTCCAGCCTCGG + Intergenic
904504411 1:30938820-30938842 GCGCCACCGTACTCCAGCCTGGG + Intronic
904543191 1:31247939-31247961 GCTCCACTGTACTCCAGCCTGGG - Intergenic
904557423 1:31374233-31374255 GCGTCACAGTACTCCAGCCTGGG - Intronic
904716982 1:32475858-32475880 GCACCACCGTACTCCAGCCTGGG - Intronic
904740850 1:32674768-32674790 GCTCTACTGAACTCCAGCCTGGG - Intronic
904875674 1:33652795-33652817 GCGCTACTGCAATCCAGCCTGGG - Intronic
905056135 1:35095446-35095468 GCGTCACTGTACTCCAGCCTGGG + Intronic
905361750 1:37425702-37425724 GCATCACTGTAATCCAGCCTGGG - Intergenic
905377279 1:37531689-37531711 GCACAACCGTAGTCCAGCCTAGG - Intergenic
905391328 1:37637502-37637524 GCATCACTGTACTCCAGCCTGGG - Intergenic
905574577 1:39033542-39033564 GCGCTACTGTACTCCAGCCTGGG - Intronic
905578943 1:39068689-39068711 GCATCACTGTATTCCAGCCTGGG + Intergenic
905591514 1:39167829-39167851 GCGTTACTGCACTCCAGCCTGGG + Intronic
905613532 1:39376756-39376778 ACACTACCGTACTCCAGCCTGGG - Intronic
905614549 1:39386301-39386323 GCACTACTGTACTCCAGCCTGGG - Intronic
905683191 1:39889333-39889355 GCACTACTGTACTCCAGCCTGGG + Intergenic
905812361 1:40922068-40922090 ACTTCACAGCAATCCAGCCTGGG - Intergenic
905821433 1:40995259-40995281 GCATCACTGTACTCCAGCCTGGG - Intronic
906054575 1:42905250-42905272 GCATCACCGCACTCCAGCCTGGG - Intergenic
906327493 1:44856470-44856492 GCACTACTGTACTCCAGCCTAGG + Intronic
906331364 1:44887853-44887875 GCATTACTGCATTCCAGCCTGGG + Intronic
906387374 1:45382279-45382301 GCACTACTGTATTCCAGCCTTGG - Intronic
906393576 1:45440671-45440693 GCACTACTGTACTCCAGCCTGGG + Intronic
906402076 1:45512119-45512141 GCGCCACCGTACTCCAGCCTGGG - Exonic
907040695 1:51256712-51256734 GCCATACTGTACTCCAGCCTGGG - Intronic
907152757 1:52304981-52305003 GCATTACTGCACTCCAGCCTGGG - Intronic
907196382 1:52690719-52690741 GCTTCACTGCACTCCAGCCTCGG - Intronic
907222581 1:52918009-52918031 GTGTTACTGTACTCCAGCCTGGG - Intronic
907265740 1:53259622-53259644 GCATTACTGCACTCCAGCCTGGG - Intronic
907541584 1:55220059-55220081 GCTCCACTGTACTCCAGCCTGGG + Intergenic
907698630 1:56760034-56760056 GCGCTACTGTATTCCAGCCTGGG + Intronic
907792291 1:57678807-57678829 TCTTCACTGTACTCCAGCCTGGG - Intronic
907797085 1:57728549-57728571 ACGTCACCGTACTCCAGCCTGGG + Intronic
908226503 1:62061222-62061244 GCACTACTGTACTCCAGCCTGGG - Intronic
908227886 1:62074474-62074496 GCACTACTGTACTCCAGCCTGGG - Intronic
908233626 1:62129894-62129916 GCTCCACTGTACTCCAGCCTGGG + Intronic
908431962 1:64067302-64067324 GCACTACTGTACTCCAGCCTGGG + Intronic
908571182 1:65411926-65411948 GCTCCACTGTACTCCAGCCTGGG + Intronic
909073678 1:71027204-71027226 GCATTACTGCACTCCAGCCTCGG - Intronic
909150338 1:71994483-71994505 GCACTACCGCACTCCAGCCTGGG + Intronic
909341391 1:74535425-74535447 GCATCACTGCAATCCAGCCTGGG + Intronic
909348087 1:74616042-74616064 GCATCACTGTACTCCAGCCTGGG - Intronic
909634937 1:77807202-77807224 GCGCCACCGTACTCCAGCCTGGG - Intronic
910174610 1:84416093-84416115 GCATCACCGCACTCCAGCCTGGG - Intergenic
910178219 1:84453867-84453889 GCTCCACTGTACTCCAGCCTGGG + Intergenic
911233625 1:95385953-95385975 GCATTACTGCATTCCAGCCTGGG + Intergenic
911708003 1:101037723-101037745 GCTTCACTGCACTCCAGCCTGGG - Intergenic
911734203 1:101319700-101319722 GCTCCACTGTACTCCAGCCTGGG - Intergenic
912229324 1:107774107-107774129 GCACCACCGTACTCCAGCCTGGG - Intronic
912621833 1:111168529-111168551 GCTCCACCGCACTCCAGCCTGGG - Intronic
912830705 1:112950952-112950974 GTTTCACTGTACTCCAGCCTGGG + Intronic
912924005 1:113897098-113897120 GCATTACTGCACTCCAGCCTGGG + Intronic
913141803 1:115948545-115948567 GCACCACCGTACTCCAGCCTGGG + Intergenic
913301783 1:117378057-117378079 GCGCCACCGTACTCCAGCCTGGG + Intronic
913494626 1:119417138-119417160 GCTTTGCCGTAATCTAACTTGGG - Intronic
913701349 1:121377309-121377331 GCACCACCGTACTCCAGCCTGGG - Intronic
914041906 1:144057770-144057792 GCACCACCGTACTCCAGCCTGGG - Intergenic
914136184 1:144902717-144902739 GCACCACCGTACTCCAGCCTGGG + Intronic
914453781 1:147816673-147816695 GCTTTAGTGTAATCTAGGCTGGG - Intergenic
914725836 1:150327108-150327130 GCGCTACTGTACTCCAGCCTGGG - Intronic
914761318 1:150600883-150600905 GCGTCACTGTACTCCAGCCTGGG + Intronic
914763407 1:150617359-150617381 GCGTCACTGTACTCCAGCCTGGG - Intronic
914834017 1:151192222-151192244 GCATCACTGTATTCCAGCCTGGG - Intronic
914835436 1:151202813-151202835 GCTCCACCGCACTCCAGCCTGGG - Intronic
914882344 1:151556929-151556951 GCGTCACTGTACTCCAGCCTGGG + Intronic
915376435 1:155400287-155400309 GCATCACTGCAATCCAGCCTGGG + Intronic
915397534 1:155597062-155597084 GCACTACCGCACTCCAGCCTGGG + Intergenic
915510986 1:156386938-156386960 GCTCTACTGTACTCCAGCCTAGG + Intergenic
915557022 1:156666398-156666420 GCATCACCGCACTCCAGCCTGGG + Intergenic
915827594 1:159094653-159094675 GCATTACTGCACTCCAGCCTGGG + Intronic
915894586 1:159802035-159802057 GCTTCAGCGTCATTCAGCCTGGG - Intronic
915961250 1:160268860-160268882 GCGCCACCGTACTCCAGCCTGGG - Intergenic
916148641 1:161764277-161764299 GCTCCACTGCAATCCAGCCTAGG + Intergenic
916149104 1:161768604-161768626 GCATCACCGCACTCCAGCCTGGG - Intronic
916160255 1:161904543-161904565 GCGCTACTGTACTCCAGCCTGGG + Intronic
916228905 1:162519271-162519293 GCTTTATGGCACTCCAGCCTGGG + Intronic
916637722 1:166691678-166691700 GCTTCACTGCACTCCAGCCTGGG + Intergenic
916919366 1:169447153-169447175 GCATCACTGTACTCCAGCCTAGG - Intronic
917113524 1:171577818-171577840 GCGTCACTGCAATCCAGCCTGGG - Intronic
917351615 1:174083999-174084021 GCATCACTGTACTCCAGCCTGGG - Intergenic
917426609 1:174920963-174920985 GCTCCACTGTACTCCAGCCTGGG - Intronic
917770690 1:178274627-178274649 GTGTTACTGTATTCCAGCCTGGG - Intronic
918027341 1:180764510-180764532 GCACTACTGCAATCCAGCCTGGG - Intronic
918237847 1:182597744-182597766 ACTCTACCGCACTCCAGCCTGGG - Intergenic
918504587 1:185238027-185238049 GCTCCACTGTACTCCAGCCTGGG - Intronic
918704084 1:187639403-187639425 GCTCCACTGTACTCCAGCCTGGG + Intergenic
918893427 1:190307309-190307331 GCTCTACTGCACTCCAGCCTGGG - Intronic
918980267 1:191548249-191548271 GCATTACTGCACTCCAGCCTTGG + Intergenic
918991486 1:191702112-191702134 GCGCTACCGTAATTCAGCCTGGG + Intergenic
919295764 1:195698169-195698191 GCATTACTGCACTCCAGCCTGGG - Intergenic
919775835 1:201193492-201193514 GCGTCACTGTACTCCAGCCTGGG - Intronic
919945607 1:202317385-202317407 GCTCTACTGCACTCCAGCCTGGG - Intronic
920004209 1:202820863-202820885 GTGTTACTGTACTCCAGCCTGGG - Intronic
920131433 1:203734958-203734980 GCTCTACTGCACTCCAGCCTGGG + Intronic
920148055 1:203879869-203879891 GCTCTACTGTACTCCAGCCTGGG + Intergenic
920328382 1:205185156-205185178 GCGCTACTGTACTCCAGCCTGGG + Intronic
920488774 1:206396023-206396045 GCACCACCGTACTCCAGCCTGGG - Intronic
920951701 1:210577688-210577710 GCACTACTGTACTCCAGCCTGGG - Intronic
921233324 1:213096620-213096642 GCGCTACTGTACTCCAGCCTGGG + Intronic
921441952 1:215197954-215197976 GCGCTACTGTACTCCAGCCTGGG + Intronic
921717470 1:218433109-218433131 GCATTACTGCACTCCAGCCTGGG - Intronic
922051723 1:221997117-221997139 GCTCCACTGTACTCCAGCCTGGG - Intergenic
922224095 1:223630377-223630399 GCGCTACTGTACTCCAGCCTGGG - Intronic
922433553 1:225580856-225580878 GCATCACTGTACTCCAGCCTGGG + Intronic
922564392 1:226592088-226592110 GCTCCACTGTACTCCAGCCTGGG - Intronic
922743554 1:228030351-228030373 GCTTCACTGTACTCCAGCCTGGG + Intronic
923064456 1:230505122-230505144 GCATTACTGCACTCCAGCCTGGG + Intergenic
923064591 1:230506315-230506337 GCACCACTGTAATCCAGCCTGGG + Intergenic
923364697 1:233247833-233247855 GCATCACTGTACTCCAGCCTAGG + Intronic
923380928 1:233417001-233417023 GCGCTACCGCACTCCAGCCTGGG + Intergenic
923473537 1:234312917-234312939 GCACCACTGTAATCCAGCCTGGG - Intronic
923688948 1:236174802-236174824 GCATCACTGTACTCCAGCCTGGG + Intronic
923777036 1:236988349-236988371 GCATTACTGCACTCCAGCCTGGG + Intergenic
923927127 1:238644429-238644451 GCTTCACTGCACTCCAGCCTGGG - Intergenic
924244795 1:242073706-242073728 GCTCCACCGCACTCCAGCCTGGG + Intergenic
924449756 1:244166843-244166865 GCAGTACCGCACTCCAGCCTGGG - Intergenic
924509258 1:244715090-244715112 GCTCTACTGCACTCCAGCCTGGG + Intergenic
924532602 1:244905922-244905944 GCACTACTGTACTCCAGCCTGGG + Intergenic
924578313 1:245300871-245300893 GCATCACCGCACTCCAGCCTGGG - Intronic
924727527 1:246684228-246684250 GCGTCACTGTACTCCAGCCTGGG - Intergenic
1062804164 10:404249-404271 GCACTACTGTACTCCAGCCTGGG - Intronic
1063050012 10:2436874-2436896 GCGTTACTGCACTCCAGCCTGGG + Intergenic
1063069204 10:2643232-2643254 GCTCCACTGTACTCCAGCCTGGG - Intergenic
1063222718 10:3985587-3985609 GCATCACTGTACTCCAGCCTGGG + Intergenic
1063394643 10:5675753-5675775 GCATCACTGTACTCCAGCCTGGG - Intergenic
1063560371 10:7120818-7120840 GCATTACTGCACTCCAGCCTGGG - Intergenic
1063933384 10:11051939-11051961 GCTCCACCGCACTCCAGCCTGGG - Intronic
1063997002 10:11628977-11628999 GCTCTACTGCACTCCAGCCTGGG - Intergenic
1064166198 10:12988387-12988409 GCACTACTGTACTCCAGCCTGGG - Intronic
1064172379 10:13045573-13045595 GCACCACCGTACTCCAGCCTGGG + Intronic
1064196661 10:13249206-13249228 GCACTACTGTACTCCAGCCTGGG - Intergenic
1064200702 10:13282547-13282569 GCATCACTGCAATCCAGCCTGGG + Intronic
1064203713 10:13305091-13305113 GCACCACCGTATTCCAGCCTGGG + Intergenic
1064312474 10:14223696-14223718 GCACTACTGCAATCCAGCCTGGG + Intronic
1064417481 10:15162972-15162994 GCACTACTGTACTCCAGCCTGGG - Intronic
1064454170 10:15471598-15471620 GCTTCACGGCATTCCAGCCTGGG - Intergenic
1064641281 10:17418099-17418121 GCACTACTGTACTCCAGCCTGGG - Intronic
1064733816 10:18360265-18360287 GCTCTACTGCACTCCAGCCTAGG - Intronic
1064812121 10:19211641-19211663 GCGCTACTGTACTCCAGCCTGGG + Intronic
1065016244 10:21465247-21465269 GCATCACTGTACTCCAGCCTGGG + Intergenic
1065041429 10:21701627-21701649 GCATTACTGCACTCCAGCCTGGG - Intronic
1065142014 10:22727058-22727080 GCACCACTGTAATCCAGCCTGGG + Intergenic
1065351791 10:24802459-24802481 ACTTCACTGTACTCCAGCCTGGG - Intergenic
1065499379 10:26364295-26364317 GCTTCACTGCACTCCAGCCTGGG - Intergenic
1065591259 10:27264504-27264526 GCGTTACCGCACTCCAGCCAGGG - Intergenic
1065627857 10:27649834-27649856 ACTCCACTGTAATCCAGCCTGGG - Intergenic
1065653836 10:27925398-27925420 GCATCACTGTACTCCAGCCTGGG - Intronic
1065751539 10:28891966-28891988 GCGTTACTGCACTCCAGCCTGGG - Intergenic
1065855188 10:29824415-29824437 GCTCCACCGCACTCCAGCCTGGG + Intergenic
1065876170 10:29999279-29999301 GCTCTACTGCACTCCAGCCTGGG + Intergenic
1065936343 10:30523723-30523745 GTACTACCGCAATCCAGCCTGGG - Intergenic
1066099584 10:32105873-32105895 GCGCTACTGTATTCCAGCCTGGG + Intergenic
1066169166 10:32823183-32823205 GCATCACTGTACTCCAGCCTGGG - Intronic
1066364334 10:34762334-34762356 GTGTTACTGTACTCCAGCCTGGG - Intronic
1066375439 10:34854049-34854071 GCGTTACTGCACTCCAGCCTGGG + Intergenic
1066406286 10:35121765-35121787 GCACTACTGTACTCCAGCCTAGG + Intergenic
1067092460 10:43275120-43275142 GCATCACTGTACTCCAGCCTGGG + Intergenic
1067098303 10:43316714-43316736 GCTTCACTGCACTCCAGCCTGGG - Intergenic
1067114220 10:43422426-43422448 GCTTCACTGCACTCCAGCCTGGG + Intergenic
1067141644 10:43662853-43662875 GCTTCACTGTATTCCAGGCTGGG - Intergenic
1067157763 10:43796311-43796333 GCTCTACAGCACTCCAGCCTGGG + Intergenic
1067306856 10:45072329-45072351 GCACTACCGTACTCCAGCTTGGG - Intergenic
1067480475 10:46593550-46593572 GCGCCACCGTACTCCAGCCTGGG + Intronic
1067607850 10:47682510-47682532 GCGTCACTGTACTCCAGCCTGGG - Intergenic
1067614263 10:47748249-47748271 GCGCCACCGTACTCCAGCCTGGG - Intergenic
1067628299 10:47941598-47941620 GCTTCACGGCACTCCAGCCTGGG + Intergenic
1067679574 10:48422073-48422095 GCATGACTGTACTCCAGCCTGGG - Intronic
1068458847 10:57299518-57299540 GCGTTACTGCACTCCAGCCTGGG - Intergenic
1068921618 10:62490399-62490421 GCTTCACTGCATTCCAGCCTGGG - Intronic
1069176469 10:65295481-65295503 GCATTACTGCACTCCAGCCTGGG - Intergenic
1069210114 10:65746987-65747009 ACTTCACTGTACTCCAGCCTGGG - Intergenic
1069233611 10:66042855-66042877 GCTCTATTGTACTCCAGCCTGGG + Intronic
1069412681 10:68169313-68169335 GCGTTACTGCACTCCAGCCTGGG + Intronic
1069497059 10:68914976-68914998 GCGCCACCGTACTCCAGCCTGGG + Intronic
1069656474 10:70093042-70093064 GCATTACTGTACTCCAGCCTGGG - Intronic
1069932247 10:71890715-71890737 GCACTACTGTACTCCAGCCTGGG - Intergenic
1070026591 10:72637913-72637935 GCCTCACTGTACTCCAGCCTGGG - Intergenic
1070067348 10:73050121-73050143 GCGCTACCGCATTCCAGCCTGGG + Intronic
1070117618 10:73543983-73544005 GCTCTACTGTACTCCTGCCTGGG - Intronic
1070225114 10:74496147-74496169 GCATTACTGCACTCCAGCCTAGG - Intronic
1070228664 10:74540500-74540522 GCATCACTGTACTCCAGCCTGGG - Intronic
1070632272 10:78095202-78095224 GCACTACCGCACTCCAGCCTGGG + Intergenic
1071056137 10:81510236-81510258 GCGTCACTGTATTCCAGCCTGGG - Intergenic
1071325763 10:84515482-84515504 GCGCCACTGTAATCCAGCCTGGG - Exonic
1071333381 10:84582968-84582990 GCACTACTGTACTCCAGCCTGGG - Intergenic
1071440437 10:85687585-85687607 GCGTCACTGTACTCCAGCCTGGG + Intronic
1071543118 10:86506190-86506212 GCATTACTGTACTCCAGTCTGGG + Intronic
1071546411 10:86533192-86533214 GCTTCACTGTACTCCAGCCTGGG + Intergenic
1071623403 10:87143904-87143926 GCGTCACTGTACTCCAGCCTGGG - Intronic
1071629669 10:87208228-87208250 ACACTACCGTACTCCAGCCTGGG - Intergenic
1071705170 10:87990049-87990071 GCATCACTGTACTCCAGCCTGGG + Intergenic
1071979419 10:90988508-90988530 GCGTCACTGTACTCCAGCCTGGG - Intergenic
1072165887 10:92812858-92812880 GCACTACCGCACTCCAGCCTGGG - Intergenic
1072257760 10:93636808-93636830 GCACCACTGTAATCCAGCCTAGG - Intronic
1072557971 10:96539313-96539335 GCATCACTGTACTCCAGCCTGGG + Intronic
1072675206 10:97460527-97460549 GCACTACTGTACTCCAGCCTGGG + Intronic
1072803056 10:98406847-98406869 GCGCCACCGTACTCCAGCCTGGG + Intronic
1072828763 10:98635737-98635759 GCATTACTGCACTCCAGCCTAGG + Intronic
1072962379 10:99940925-99940947 GCGCCACCGTACTCCAGCCTGGG - Intronic
1072973491 10:100037825-100037847 GCATCACTGTACTCCAGCCTGGG - Intergenic
1073001267 10:100287731-100287753 ACGTTACTGTACTCCAGCCTGGG - Intergenic
1073087499 10:100902762-100902784 GCGCTACCGCACTCCAGCCTGGG - Intergenic
1073141409 10:101250744-101250766 GCTCCACTGTACTCCAGCCTGGG - Intergenic
1073348926 10:102805234-102805256 TCTCTACTGTACTCCAGCCTGGG + Intronic
1073382495 10:103090258-103090280 GCTCCACTGTACTCCAGCCTGGG - Intronic
1073906065 10:108281024-108281046 GCGCTACTGTACTCCAGCCTGGG + Intergenic
1074551406 10:114445811-114445833 GCATCACTGTACTCCAGCCTGGG - Intronic
1074594151 10:114844825-114844847 GCTTCACTGCACTCCAGCCTGGG - Intronic
1075500579 10:122970077-122970099 GCGTCACTGTACTCCAGCCTGGG + Intronic
1075560003 10:123461219-123461241 GCTCTACTGCACTCCAGCCTAGG - Intergenic
1075742267 10:124703082-124703104 GCACTACCGCACTCCAGCCTGGG - Intronic
1075964184 10:126596258-126596280 GCTCCACCGCACTCCAGCCTGGG + Intronic
1076000974 10:126912681-126912703 GCGCCACCGTACTCCAGCCTGGG + Intronic
1076289639 10:129335129-129335151 GCATCACTGTACTCCAGCCTGGG - Intergenic
1076587328 10:131558372-131558394 GCATCACTGTACTCCAGCCTGGG + Intergenic
1076931535 10:133534905-133534927 GCATCACCGCACTCCAGCCTGGG - Intronic
1077267290 11:1657588-1657610 GCACCACTGTAATCCAGCCTGGG + Intergenic
1077381245 11:2239504-2239526 GCTTCACTGCACTCCAGCCTGGG + Intergenic
1077617661 11:3689681-3689703 GCATCACTGTACTCCAGCCTGGG - Intronic
1077643643 11:3904152-3904174 GCTCCACTGTACTCCAGCCTGGG + Intronic
1078113595 11:8422865-8422887 GCATTACTGCACTCCAGCCTGGG - Intronic
1078208596 11:9251944-9251966 GCACCACCGTACTCCAGCCTGGG + Intronic
1078233681 11:9464878-9464900 GCGTCACTGTATTCCAGCCTGGG + Intronic
1078335109 11:10457018-10457040 GCACCACCGTACTCCAGCCTGGG - Intronic
1078382047 11:10851187-10851209 GCGCCACTGTAATCCAGCCTGGG + Intronic
1078995785 11:16697565-16697587 GCTTCACTGCACTCCAGCCTGGG + Intronic
1079066487 11:17298739-17298761 GCATCACTGTACTCCAGCCTGGG - Intronic
1079164731 11:18029035-18029057 GCATCACTGTACTCCAGCCTGGG + Intronic
1079215620 11:18508262-18508284 GCATTACTGCACTCCAGCCTGGG - Intronic
1079445481 11:20553026-20553048 GCACCACCGTACTCCAGCCTGGG + Intergenic
1079526208 11:21391685-21391707 GCATTACCGCACTCCAGACTGGG - Intronic
1079834451 11:25315761-25315783 GCTTCACTGTACTCCAGCCTGGG - Intergenic
1079941447 11:26685563-26685585 ACACTACTGTAATCCAGCCTGGG + Intronic
1080056336 11:27910436-27910458 GCATCACCGCATTCCAGCCTCGG + Intergenic
1080615637 11:33942589-33942611 GCATTACTGCACTCCAGCCTTGG + Intergenic
1080758676 11:35226925-35226947 GCATCACCGCACTCCAGCCTGGG - Intronic
1080855934 11:36111641-36111663 GCTCTACTGCACTCCAGCCTGGG - Intronic
1080866861 11:36203143-36203165 GCACTACCGTACTCCAGCCTGGG - Intronic
1081465571 11:43313062-43313084 GCTTCACTGCACTCCAGCCTGGG + Intronic
1081475377 11:43424725-43424747 GCATCATCGTACTCCAGCCTGGG + Intronic
1081900335 11:46622158-46622180 GCTTCACCGCACTCCAGTCTGGG - Intronic
1082633889 11:55573137-55573159 GATTTAATGTAATCCTGCCTTGG + Intergenic
1083025019 11:59543301-59543323 GCATCACTGTACTCCAGCCTGGG + Intergenic
1083481058 11:62947231-62947253 GCTTGATTGTACTCCAGCCTGGG + Intronic
1083578507 11:63809973-63809995 GCGCCACCGCAATCCAGCCTGGG - Intergenic
1083767849 11:64850691-64850713 GCATCACTGTACTCCAGCCTGGG - Intergenic
1083845520 11:65330326-65330348 GCTCCACTGTACTCCAGCCTGGG - Intergenic
1083886847 11:65577200-65577222 GCTGTGCCCTAATCCAGCCAAGG - Intronic
1084099627 11:66937817-66937839 GCATCACTGTACTCCAGCCTAGG - Intronic
1084265031 11:68000620-68000642 GCGTCACCGCACTCCAGCCTGGG + Intronic
1084337556 11:68469419-68469441 GCTATACTGCACTCCAGCCTGGG - Intronic
1084718420 11:70888772-70888794 GCTCCACTGTACTCCAGCCTGGG + Intronic
1085070616 11:73541160-73541182 GCATTACCGCACTCCAGCCTGGG + Intronic
1085142224 11:74156416-74156438 GCATCACTGTACTCCAGCCTGGG + Intronic
1085146952 11:74209147-74209169 GCATCACTGTACTCCAGCCTGGG - Intronic
1085286638 11:75366763-75366785 GCTCCACCGCACTCCAGCCTGGG + Intergenic
1085435386 11:76494776-76494798 GCATTACTGCACTCCAGCCTGGG - Intronic
1085573098 11:77576676-77576698 GCATCACTGTACTCCAGCCTGGG - Intronic
1086356686 11:86008575-86008597 GCTCCACCGCACTCCAGCCTGGG + Intronic
1086605232 11:88687432-88687454 GCTTCACTGCACTCCAGCCTGGG + Intronic
1087750028 11:101997078-101997100 GCTCCACTGTACTCCAGCCTGGG - Intronic
1087858571 11:103124401-103124423 GCTGTACTGCACTCCAGCCTGGG + Intronic
1087875735 11:103354132-103354154 GCGCCACCGTACTCCAGCCTGGG + Intronic
1088039626 11:105362850-105362872 GCACTACTGTACTCCAGCCTGGG - Intergenic
1088111250 11:106264676-106264698 GCATAACCGCACTCCAGCCTGGG + Intergenic
1088861636 11:113805837-113805859 TCTTGACCCTAACCCAGCCTTGG - Intronic
1088864324 11:113832811-113832833 GCACTACTGTACTCCAGCCTGGG - Intronic
1089012500 11:115142482-115142504 GCATTACTGCACTCCAGCCTGGG - Intergenic
1089167764 11:116490414-116490436 GCATCACCGCATTCCAGCCTGGG - Intergenic
1089426485 11:118380537-118380559 GCACTACTGTACTCCAGCCTGGG + Intronic
1089507525 11:118973734-118973756 GCGCTACTGTACTCCAGCCTGGG - Intronic
1089517621 11:119043657-119043679 GCATTACTATACTCCAGCCTGGG + Intergenic
1089867893 11:121648030-121648052 GCATCACTGTACTCCAGCCTGGG - Intergenic
1090016705 11:123092638-123092660 GCATCACTGTACTCCAGCCTGGG - Intronic
1090018408 11:123105857-123105879 GCGCTACTGTACTCCAGCCTGGG - Intronic
1090049884 11:123368635-123368657 GCATCACTGTACTCCAGCCTGGG + Intergenic
1090063930 11:123487645-123487667 GCATCACTGTACTCCAGCCTGGG - Intergenic
1090263087 11:125335773-125335795 GCTCCACTGTACTCCAGCCTGGG + Intronic
1090360730 11:126170869-126170891 ACATTACTGTACTCCAGCCTAGG + Intergenic
1090373378 11:126272352-126272374 GTTATACCGTACTCCAGCCTGGG - Intronic
1090539668 11:127687468-127687490 GCATCACTGTACTCCAGCCTGGG - Intergenic
1090560523 11:127927400-127927422 GCTCCACTGTATTCCAGCCTGGG - Intergenic
1091101509 11:132878137-132878159 GCACTACTGTACTCCAGCCTGGG + Intronic
1091439284 12:500184-500206 GCTCCACTGTACTCCAGCCTGGG - Intronic
1091439851 12:504236-504258 GCATTACTGCACTCCAGCCTGGG + Intronic
1091486401 12:893212-893234 GCATCACTGTACTCCAGCCTGGG + Intronic
1091744173 12:2980688-2980710 GCTCCACTGTACTCCAGCCTGGG + Intronic
1092190833 12:6519389-6519411 GCGCTACTGTACTCCAGCCTGGG - Intronic
1092248423 12:6877045-6877067 GCGCTACCGCACTCCAGCCTGGG + Intronic
1092269985 12:7016317-7016339 GCTCTACTGCACTCCAGCCTGGG - Intronic
1092346151 12:7716058-7716080 GCTCCACTGCAATCCAGCCTGGG + Intronic
1092413217 12:8270070-8270092 GTTTCACTGAAATCCAGCCTGGG - Intergenic
1092620137 12:10254848-10254870 GCGCTACCGCACTCCAGCCTAGG + Intergenic
1092867205 12:12773517-12773539 GCATCACTGTACTCCAGCCTAGG + Intronic
1093051548 12:14510349-14510371 GCACCACCGTACTCCAGCCTGGG + Intronic
1093159865 12:15733899-15733921 GCATCACTGTACTCCAGCCTGGG - Intronic
1093454118 12:19347923-19347945 GCTCTACTGCACTCCAGCCTGGG - Intronic
1093458640 12:19388419-19388441 GCTCTACTGCACTCCAGCCTGGG - Intergenic
1093485297 12:19645764-19645786 GCTTCACTGCACTCCAGCCTGGG + Intronic
1093489352 12:19687067-19687089 GCATTACTGTACTCTAGCCTGGG + Intronic
1093774498 12:23056674-23056696 GCACTACTGTACTCCAGCCTGGG + Intergenic
1093870838 12:24289236-24289258 GCATCACTGTACTCCAGCCTGGG + Intergenic
1093937012 12:25012195-25012217 GCATCACTGTATTCCAGCCTGGG - Intergenic
1094021484 12:25919099-25919121 GCTCCACTGTACTCCAGCCTGGG - Intergenic
1094036702 12:26079546-26079568 GCATTACTGCACTCCAGCCTGGG + Intronic
1094165331 12:27437226-27437248 GTGCTACCGTACTCCAGCCTGGG + Intergenic
1094195265 12:27742897-27742919 GCTCTACTGCACTCCAGCCTGGG - Intronic
1094199850 12:27784175-27784197 GCGTCACTGTACTCCAGCCTGGG - Intronic
1094502681 12:31035222-31035244 CCTCTACTGTATTCCAGCCTGGG + Intergenic
1094563131 12:31574545-31574567 GCGTCACCGCACTCCAGCCTGGG + Intronic
1094582832 12:31750131-31750153 GCACCACCGTACTCCAGCCTGGG + Intergenic
1094613032 12:32011970-32011992 GCATCACTGTATTCCAGCCTGGG - Intergenic
1094653894 12:32402353-32402375 GTTTCACTGTATTCCAGCCTGGG + Intronic
1095214831 12:39536045-39536067 GCGTCACCGCACTCCAGCCTGGG + Intergenic
1095258072 12:40064200-40064222 GCTCCACTGTACTCCAGCCTGGG + Intronic
1095884456 12:47174364-47174386 GCGCTACCGCACTCCAGCCTAGG + Intronic
1096091027 12:48901184-48901206 GCATCACTGTACTCCAGCCTGGG + Intergenic
1096170597 12:49466204-49466226 GCTCCACTGTACTCCAGCCTGGG - Intronic
1096404395 12:51332814-51332836 ACGCTACCGTACTCCAGCCTGGG + Intronic
1096412137 12:51384647-51384669 GCACCACCGTACTCCAGCCTGGG + Intronic
1096732981 12:53629333-53629355 GCGTTACCGCACTCCAGCCTGGG - Intergenic
1096739695 12:53683769-53683791 GCATTACTGCACTCCAGCCTGGG + Intergenic
1096746839 12:53734402-53734424 GCATCACTGTACTCCAGCCTGGG + Intergenic
1096989297 12:55786490-55786512 GCGCCACCGTACTCCAGCCTGGG - Intronic
1096989913 12:55792412-55792434 GCTCCACTGTACTCCAGCCTGGG - Intronic
1097017678 12:55998839-55998861 GCGCCACCGTACTCCAGCCTGGG - Intronic
1097122451 12:56745366-56745388 ACGTTACCGTACTCCAGCCTGGG + Intronic
1097258797 12:57701316-57701338 GCACTACTGTATTCCAGCCTGGG - Intronic
1097556561 12:61146286-61146308 GCGCTACTGTACTCCAGCCTGGG + Intergenic
1097632549 12:62081525-62081547 GCACCACCGTACTCCAGCCTGGG - Intronic
1098238870 12:68445536-68445558 GCACCACCGTACTCCAGCCTGGG - Intergenic
1098889835 12:75998355-75998377 GCATCACTGTACTCCAGCCTGGG + Intergenic
1099337823 12:81386577-81386599 GCATTAGCGCACTCCAGCCTGGG + Intronic
1099711534 12:86232090-86232112 GCGCCACCGTACTCCAGCCTGGG + Intronic
1099965005 12:89436669-89436691 GCTATACTGTATTCCAGCTTGGG + Intronic
1100142077 12:91631656-91631678 GCGCCACCGCAATCCAGCCTGGG - Intergenic
1100269666 12:93012574-93012596 GCTCCACTGTACTCCAGCCTGGG + Intergenic
1100477317 12:94946457-94946479 GCACTACTGTACTCCAGCCTGGG - Intronic
1100541776 12:95563953-95563975 GCGCTACCGCACTCCAGCCTGGG + Intergenic
1100544180 12:95585872-95585894 GCTCCACCGCACTCCAGCCTGGG - Intergenic
1100844860 12:98647413-98647435 ACTCTACTGTACTCCAGCCTGGG - Intronic
1100928956 12:99584552-99584574 GCATCACTGTACTCCAGCCTGGG + Intronic
1100994752 12:100292858-100292880 GCACTACTGTAATCCAGCTTGGG - Intronic
1101133195 12:101710300-101710322 CCTTTACTGCACTCCAGCCTGGG + Intronic
1101666410 12:106819699-106819721 GCATTACCGCATTCCCGCCTGGG + Intronic
1101765400 12:107693692-107693714 GCTCCACTGTACTCCAGCCTGGG + Intronic
1101865051 12:108514684-108514706 GCTCCACCGCACTCCAGCCTGGG + Intergenic
1101900239 12:108786639-108786661 GCACTACTGTACTCCAGCCTAGG + Exonic
1101966010 12:109282403-109282425 GCACTACTGTACTCCAGCCTGGG + Intronic
1102110807 12:110364526-110364548 GCCCTACTGTATTCCAGCCTGGG + Intergenic
1102111602 12:110369486-110369508 GCATCACTGTACTCCAGCCTGGG - Intergenic
1102144485 12:110644633-110644655 GCCTCACTGTACTCCAGCCTGGG + Intronic
1102233589 12:111280244-111280266 GCGCTACCCTACTCCAGCCTGGG + Intronic
1102264112 12:111467183-111467205 GCACCACTGTAATCCAGCCTGGG - Intronic
1102282266 12:111627630-111627652 GCCTCACTGTACTCCAGCCTGGG + Intergenic
1102311392 12:111847303-111847325 GCTCCACTGTACTCCAGCCTGGG + Intronic
1102373123 12:112399209-112399231 GCATCACCGCACTCCAGCCTGGG + Intergenic
1102393894 12:112571844-112571866 GCACTACTGTACTCCAGCCTGGG + Intronic
1102411698 12:112725836-112725858 GCATCACCGCACTCCAGCCTGGG - Intronic
1102494722 12:113311576-113311598 GCATCACTGTACTCCAGCCTGGG + Intronic
1102496732 12:113324744-113324766 GCTCTACTGCACTCCAGCCTAGG - Intronic
1102592191 12:113965237-113965259 GCTCCACCGCAGTCCAGCCTGGG + Intronic
1102625454 12:114232135-114232157 GCATCACTGTACTCCAGCCTGGG - Intergenic
1102627245 12:114244955-114244977 CCTTTACCCCAATCCAGCTTTGG + Intergenic
1102684149 12:114711193-114711215 GCTCCACTGTATTCCAGCCTAGG + Intergenic
1102821287 12:115911089-115911111 GCGCCACCGTACTCCAGCCTGGG + Intergenic
1102927040 12:116834159-116834181 GCGCTACCGAACTCCAGCCTGGG - Intronic
1103072695 12:117957872-117957894 GCATCACTGTACTCCAGCCTGGG - Intronic
1103274914 12:119703466-119703488 GCACTACCGCATTCCAGCCTGGG - Intronic
1103324600 12:120112021-120112043 GCGCCACCGTACTCCAGCCTGGG - Intronic
1103382877 12:120508342-120508364 ACGTTACTGTACTCCAGCCTGGG + Intronic
1103404589 12:120666429-120666451 GCATCACCGCACTCCAGCCTGGG + Intronic
1103497139 12:121371549-121371571 GCACTACTGTACTCCAGCCTGGG - Intronic
1103513201 12:121489480-121489502 GCATCACTGTACTCCAGCCTGGG - Intronic
1103545736 12:121699963-121699985 GCACTACCGCACTCCAGCCTGGG - Intergenic
1103649223 12:122420631-122420653 GCTTTAATGTAGACCAGCCTTGG + Intronic
1103668118 12:122587234-122587256 GCACTACTGTACTCCAGCCTGGG + Intronic
1103672453 12:122629046-122629068 GCTTCACTGCACTCCAGCCTGGG - Intergenic
1103705554 12:122869650-122869672 GCATTACTGTACTCCACCCTGGG - Intronic
1103757263 12:123218566-123218588 GCGCCACCGTACTCCAGCCTGGG - Intronic
1103768604 12:123301834-123301856 GCTGCACTGTACTCCAGCCTAGG + Intronic
1103790019 12:123463418-123463440 GCATCACCGCACTCCAGCCTGGG - Intronic
1103818643 12:123679402-123679424 GCATCACCATACTCCAGCCTGGG - Intronic
1103902382 12:124310128-124310150 GCACTACCGTACTCTAGCCTGGG + Intronic
1103981462 12:124739515-124739537 GCATGACCGCACTCCAGCCTGGG - Intergenic
1103987777 12:124778991-124779013 GCACCACCGTACTCCAGCCTGGG - Intronic
1104207443 12:126653446-126653468 GCTTCACTGCACTCCAGCCTGGG - Intergenic
1105059356 12:133134268-133134290 GCTTCACTGCACTCCAGCCTGGG + Intronic
1105245836 13:18649360-18649382 GCTCAACTGTACTCCAGCCTGGG + Intergenic
1105394117 13:20012216-20012238 GCACTACCGCACTCCAGCCTGGG - Intronic
1105497603 13:20944449-20944471 GCTCCACCGCACTCCAGCCTGGG + Intergenic
1105839946 13:24245632-24245654 GCACTACTGCAATCCAGCCTGGG - Intronic
1105882625 13:24617192-24617214 GCACCACCGTACTCCAGCCTGGG + Intergenic
1105929597 13:25040084-25040106 GCGCCACCGTACTCCAGCCTGGG + Intergenic
1106260770 13:28064527-28064549 GCACTACTGTACTCCAGCCTGGG + Intronic
1106275417 13:28201073-28201095 GCATTACTGCATTCCAGCCTGGG - Intronic
1106321593 13:28644412-28644434 GCGCCACCGTACTCCAGCCTGGG + Intergenic
1106536951 13:30654233-30654255 GCTGTACCCTAGACCAGCCTTGG + Intronic
1107159929 13:37214227-37214249 ACATTACTGTACTCCAGCCTGGG - Intergenic
1107465199 13:40643297-40643319 GCTCCACTGTACTCCAGCCTGGG + Intronic
1107554010 13:41501798-41501820 GCATCACTGTACTCCAGCCTGGG + Intergenic
1107656771 13:42599605-42599627 GCACCACTGTAATCCAGCCTGGG - Intronic
1107713064 13:43169753-43169775 GCGTCACTGTACTCCAGCCTGGG - Intergenic
1107773188 13:43810604-43810626 GCTCCACTGTACTCCAGCCTGGG - Intergenic
1107925895 13:45261381-45261403 GCATCACTGTACTCCAGCCTGGG + Intronic
1108116548 13:47135039-47135061 GCTCTACTGCACTCCAGCCTAGG + Intergenic
1108219883 13:48222492-48222514 GCGTCACCATACTCCAGCCTGGG + Intergenic
1108562686 13:51662011-51662033 GCAATACTGTACTCCAGCCTAGG - Intronic
1108730847 13:53234076-53234098 GCTCCACTGTACTCCAGCCTGGG - Intergenic
1109106647 13:58260463-58260485 GCTTCACTGTACTCCAGCCTGGG + Intergenic
1109445217 13:62429350-62429372 GCACTACAGTACTCCAGCCTGGG - Intergenic
1109599239 13:64601267-64601289 GCGTCACTGTACTCCAGCCTAGG + Intergenic
1109732751 13:66437360-66437382 GCTCCACCGCACTCCAGCCTGGG + Intronic
1110210908 13:72972075-72972097 GCTCCACTGTATTCCAGCCTGGG - Intronic
1110436821 13:75484974-75484996 GCGTCACTGTACTCCAGCCTGGG + Intergenic
1111031327 13:82603250-82603272 GCACCACCGTACTCCAGCCTAGG - Intergenic
1111857740 13:93661254-93661276 GCTTCACTGCACTCCAGCCTGGG - Intronic
1112076078 13:95914758-95914780 GCATCACCGCACTCCAGCCTGGG + Intronic
1112267760 13:97940908-97940930 ACACTACCGTATTCCAGCCTGGG + Intergenic
1112274610 13:98004936-98004958 GCGTTATCGCACTCCAGCCTGGG - Intronic
1112472232 13:99699648-99699670 GCGCCACCGTACTCCAGCCTGGG + Intronic
1113299182 13:108997793-108997815 GCACCACCGTACTCCAGCCTGGG + Intronic
1113321517 13:109236812-109236834 GCTCTACTGCACTCCAGCCTGGG + Intergenic
1114294684 14:21318516-21318538 GCATCACTGTACTCCAGCCTGGG - Intronic
1114301140 14:21379391-21379413 GCTTCACTGCATTCCAGCCTGGG + Intronic
1114310780 14:21464954-21464976 ACGTTACTGTACTCCAGCCTGGG + Intronic
1114385616 14:22251379-22251401 GCATCACTGCAATCCAGCCTGGG - Intergenic
1114431044 14:22661006-22661028 GCGTCACTGTACTCCAGCCTGGG - Intergenic
1114507484 14:23228604-23228626 ACATTAACGCAATCCAGCCTGGG + Intronic
1114566228 14:23635103-23635125 GCACCACCGTACTCCAGCCTGGG - Intronic
1114623145 14:24111022-24111044 GCTCCACTGTACTCCAGCCTGGG - Intronic
1114918953 14:27302328-27302350 GCACCACTGTAATCCAGCCTGGG - Intergenic
1115216294 14:31017109-31017131 GTTTTACTGCACTCCAGCCTGGG + Intronic
1115260004 14:31442285-31442307 GCACTACCGCACTCCAGCCTGGG - Intronic
1115389913 14:32842638-32842660 ACTCTACTGTACTCCAGCCTGGG + Intergenic
1115632199 14:35256239-35256261 GCACCACCGTACTCCAGCCTGGG + Intronic
1115701151 14:35954138-35954160 GCATTACTGCACTCCAGCCTGGG + Intergenic
1115758349 14:36552451-36552473 GCACCACTGTAATCCAGCCTGGG - Intergenic
1115985715 14:39102620-39102642 ACGTCACCGTAATTCAGCCTTGG - Intronic
1116020339 14:39453161-39453183 GCATTACTGCACTCCAGCCTGGG - Intergenic
1116636601 14:47404226-47404248 GCATCACTGTACTCCAGCCTGGG - Intronic
1116682251 14:47986977-47986999 GCGTCACTGTACTCCAGCCTGGG + Intergenic
1117154141 14:52920903-52920925 GCACCACCGTACTCCAGCCTGGG + Intronic
1117389858 14:55252312-55252334 GCATCACCGCACTCCAGCCTGGG + Intergenic
1118031106 14:61818633-61818655 GCTTCACCGCACTCCAGCCTGGG + Intergenic
1118293494 14:64547531-64547553 GCACTACCGTATTCCAGCCCGGG + Intergenic
1118353643 14:64992659-64992681 GCATCACCGCACTCCAGCCTGGG - Intronic
1118804813 14:69226703-69226725 GCACTACTGTACTCCAGCCTAGG + Intronic
1118813945 14:69295675-69295697 GCACTACTGTACTCCAGCCTGGG + Intronic
1118817354 14:69322846-69322868 GCAGTACCGTACTCCAGCCTGGG + Intronic
1118868093 14:69718854-69718876 GCTTCACTGCACTCCAGCCTGGG + Intergenic
1119036825 14:71237280-71237302 GCATCACCGCACTCCAGCCTGGG - Intergenic
1119255588 14:73193265-73193287 GCATCACTGTATTCCAGCCTGGG + Intronic
1119283120 14:73427420-73427442 GCGTCACCGTACTCCAGCTTGGG + Intronic
1119342353 14:73890229-73890251 GCGTCACTGTACTCCAGCCTGGG - Intronic
1119743887 14:77030770-77030792 GCGTCACTGTACTCCAGCCTGGG - Intergenic
1119834761 14:77738535-77738557 GTGTCACCGTACTCCAGCCTGGG + Intronic
1119837708 14:77765683-77765705 GCGTCACTGTACTCCAGCCTGGG - Intronic
1120220795 14:81730428-81730450 GCGCTACCGCACTCCAGCCTGGG + Intergenic
1120242217 14:81962745-81962767 GCTCCACTGTACTCCAGCCTGGG - Intergenic
1120597127 14:86454496-86454518 GCATCACTGTACTCCAGCCTAGG - Intergenic
1120679978 14:87469569-87469591 GCTCTACTGCACTCCAGCCTGGG - Intergenic
1120811037 14:88803710-88803732 GCATTACTGCACTCCAGCCTGGG - Intergenic
1120868038 14:89312240-89312262 GCACTACTGTACTCCAGCCTGGG + Intronic
1121008602 14:90506424-90506446 GCGTCACCGCACTCCAGCCTGGG + Intergenic
1121036856 14:90713156-90713178 GCTCTACTGTACTCCAGCCCGGG - Intronic
1121074144 14:91052789-91052811 GCGTCACTGTACTCCAGCCTGGG + Intronic
1121261959 14:92572922-92572944 GCACTACTGTACTCCAGCCTGGG - Intronic
1121355835 14:93213967-93213989 GCACTACTGTACTCCAGCCTGGG - Intronic
1122056648 14:99102911-99102933 GCGCCACTGTAATCCAGCCTGGG + Intergenic
1122111650 14:99507521-99507543 GCACCACCGTACTCCAGCCTGGG + Exonic
1122185109 14:99986247-99986269 GCACCACCGTACTCCAGCCTGGG + Intronic
1122459979 14:101886766-101886788 GCATCACTGTACTCCAGCCTGGG - Intronic
1122472892 14:101984008-101984030 ACTTCACTGTACTCCAGCCTAGG - Intronic
1122524319 14:102369910-102369932 GCATCACTGTACTCCAGCCTGGG + Intronic
1122705824 14:103620680-103620702 GCATTACTGCATTCCAGCCTGGG - Intronic
1122769137 14:104089903-104089925 GCATCACTGTACTCCAGCCTGGG + Intronic
1123791330 15:23723683-23723705 GCTCTACTGTACTCCAGCCTGGG + Intergenic
1124023606 15:25945106-25945128 GCTCCACCGCACTCCAGCCTGGG - Intergenic
1124107085 15:26748980-26749002 GCATTACTGCACTCCAGCCTGGG + Intronic
1124132416 15:27002920-27002942 GCATCACTGTATTCCAGCCTGGG + Intronic
1124215165 15:27800922-27800944 GCATCACTGTACTCCAGCCTAGG + Intronic
1124551661 15:30686539-30686561 GCACTACCGCACTCCAGCCTGGG + Intronic
1124679587 15:31719125-31719147 GCACTACCGCACTCCAGCCTGGG - Intronic
1124843438 15:33266136-33266158 GCACTACTGTACTCCAGCCTGGG + Intergenic
1124944043 15:34246687-34246709 GCGTCACTGTACTCCAGCCTTGG - Intronic
1125025689 15:35026904-35026926 GCTCCACTGCAATCCAGCCTGGG + Intergenic
1125558627 15:40608389-40608411 GAGTTACTGTACTCCAGCCTGGG + Intronic
1125607225 15:40947334-40947356 ACTCTACTGTACTCCAGCCTGGG - Intergenic
1125740998 15:41964561-41964583 GCATCACTGTACTCCAGCCTGGG + Intronic
1125867679 15:43068661-43068683 GCGCCACCGTACTCCAGCCTGGG - Intronic
1125913263 15:43461260-43461282 GCATTACTGCACTCCAGCCTGGG - Intronic
1126019647 15:44387716-44387738 GCGATACTGTACTCCAGCCTGGG + Intronic
1126091791 15:45059286-45059308 GCATCACTGTACTCCAGCCTGGG + Intronic
1126153758 15:45546499-45546521 GCACTACCGCACTCCAGCCTAGG - Intergenic
1126597811 15:50399257-50399279 GCTTCACCGTACTCCAGCCTGGG + Intergenic
1126750529 15:51872348-51872370 GCTCTACTGTACTCCAGCCTGGG + Intronic
1126858758 15:52863748-52863770 GCATCACTGTACTCCAGCCTGGG + Intergenic
1126940121 15:53758042-53758064 GCTTCACTGTACTCCAGGCTAGG - Intronic
1127067177 15:55252557-55252579 GCACTACTGTACTCCAGCCTGGG + Intronic
1127108481 15:55643028-55643050 GTGCTACCGTACTCCAGCCTGGG + Intronic
1127237734 15:57073789-57073811 GCGCCACCGTACTCCAGCCTGGG - Intronic
1127239552 15:57097482-57097504 ACTTCACTGTATTCCAGCCTGGG + Intronic
1127247823 15:57197197-57197219 GCACTACTGTACTCCAGCCTGGG - Intronic
1127274012 15:57426487-57426509 GCACTACTATAATCCAGCCTGGG - Intronic
1127455920 15:59155910-59155932 GCACTACTGTACTCCAGCCTGGG - Intronic
1127835389 15:62786941-62786963 GCACTACTGTACTCCAGCCTGGG - Intronic
1128330008 15:66749573-66749595 GCTCCACTGTACTCCAGCCTGGG + Intronic
1128965891 15:72057062-72057084 GCACCACCGTACTCCAGCCTGGG + Intronic
1129423084 15:75445336-75445358 GCGCTACTGTACTCCAGCCTGGG + Intronic
1129432222 15:75507722-75507744 GCTTCACTGCACTCCAGCCTGGG + Intronic
1129751819 15:78070698-78070720 GCTCCACTGTACTCCAGCCTGGG - Intronic
1129753343 15:78081294-78081316 GCGTCACCGCACTCCAGCCTGGG - Intronic
1129789724 15:78332649-78332671 GCTCCACTGTACTCCAGCCTGGG - Intergenic
1129814949 15:78543609-78543631 GCGTCACCGTACTCCAGCCTGGG - Intronic
1129860365 15:78855792-78855814 GCGCCACCGTACTCCAGCCTGGG + Intronic
1130000917 15:80045797-80045819 GCATTACTGCACTCCAGCCTGGG + Intergenic
1130359560 15:83169755-83169777 GCATCACTGTACTCCAGCCTGGG + Intronic
1130725848 15:86438702-86438724 GCACCACCGTACTCCAGCCTGGG - Intronic
1131095320 15:89650972-89650994 GCTTCACTGCATTCCAGCCTGGG - Intronic
1131175185 15:90204816-90204838 GCATCACTGTACTCCAGCCTGGG - Intronic
1131237310 15:90708072-90708094 GCACTACCGCACTCCAGCCTGGG - Intergenic
1131291794 15:91112857-91112879 GCACCACTGTAATCCAGCCTGGG - Intronic
1131488361 15:92840776-92840798 ACTCCACCGTACTCCAGCCTGGG + Intergenic
1132047058 15:98573019-98573041 GCTCCACTGTACTCCAGCCTTGG - Intergenic
1132097061 15:98994541-98994563 GCTATACTGCATTCCAGCCTGGG + Intronic
1132270376 15:100519114-100519136 GCGTCACTGTACTCCAGCCTGGG + Intronic
1132470456 16:99888-99910 GCACTACTGAAATCCAGCCTGGG + Intronic
1132782625 16:1636326-1636348 GCGTCACCGCACTCCAGCCTGGG + Intronic
1132872166 16:2120167-2120189 GCATCACTGTACTCCAGCCTGGG + Intronic
1132949302 16:2551707-2551729 GCGTCACCGCATTCCAGCCTGGG - Intronic
1133070186 16:3241583-3241605 GCACTACGGCAATCCAGCCTGGG - Intergenic
1133089506 16:3392781-3392803 GCATTACTGCACTCCAGCCTGGG + Intronic
1133311988 16:4854384-4854406 GCATCACCGCACTCCAGCCTGGG - Intronic
1133349627 16:5092915-5092937 GTGTCACGGTAATCCAGCCTGGG + Intronic
1133445538 16:5857902-5857924 GCACTGCCGTACTCCAGCCTGGG + Intergenic
1133479756 16:6158943-6158965 GCACTACTGTACTCCAGCCTGGG - Intronic
1133595397 16:7286490-7286512 GCATCACTGTACTCCAGCCTAGG - Intronic
1133705728 16:8352846-8352868 GCTCCACTGCAATCCAGCCTAGG + Intergenic
1133736254 16:8618047-8618069 GCGTCACTGTACTCCAGCCTGGG - Intergenic
1133945136 16:10341685-10341707 GCTTCACTGCACTCCAGCCTGGG - Intronic
1134078200 16:11307081-11307103 GCACTACTGTACTCCAGCCTGGG + Intronic
1134323005 16:13180653-13180675 GCATCACCGCACTCCAGCCTAGG + Intronic
1134369016 16:13606339-13606361 CCGTCACTGTAATCCAGCCTGGG + Intergenic
1134447546 16:14342447-14342469 GCATCACCGCACTCCAGCCTGGG - Intergenic
1134482887 16:14633693-14633715 GCTCCACCGCACTCCAGCCTGGG - Intronic
1134598541 16:15515037-15515059 GCTTCACCGCACTCCAGCCTGGG + Intronic
1134622675 16:15701192-15701214 GCGCTACTGTACTCCAGCCTGGG + Intronic
1134632860 16:15769455-15769477 GCGCCACCGTACTCCAGCCTAGG + Intronic
1134679986 16:16117861-16117883 GCATCACTGCAATCCAGCCTGGG + Intronic
1134700303 16:16259389-16259411 GCGCCACCGTACTCCAGCCTGGG - Intronic
1134777468 16:16865565-16865587 TATTTACCGTACTCCAGCCTGGG + Intergenic
1134882403 16:17757228-17757250 GCACCACCGTACTCCAGCCTAGG - Intergenic
1135021526 16:18966926-18966948 GCATTACTGCACTCCAGCCTAGG + Intergenic
1135338406 16:21624682-21624704 GCTCTACTGTACTCCAGCCTGGG + Intronic
1135431418 16:22386861-22386883 GCACCACCGTACTCCAGCCTGGG + Intronic
1135569510 16:23537832-23537854 ACTCTACTGTACTCCAGCCTGGG - Intronic
1135677914 16:24432880-24432902 ACTTTACCGCACTCCAACCTAGG - Intergenic
1135681113 16:24457914-24457936 GCATTACTGCACTCCAGCCTGGG - Intergenic
1135687298 16:24508051-24508073 GCACCACCGTACTCCAGCCTGGG + Intergenic
1135746743 16:25023664-25023686 GCGTCACCGCAATCTAGCCTGGG - Intergenic
1135768848 16:25200679-25200701 GCATTACTGCACTCCAGCCTGGG + Intergenic
1135803333 16:25519645-25519667 GCACTACCGCACTCCAGCCTGGG - Intergenic
1135950784 16:26912124-26912146 GCCTTACTGCACTCCAGCCTGGG + Intergenic
1136035987 16:27540881-27540903 GCGTCACTGTACTCCAGCCTGGG - Intronic
1136123918 16:28162602-28162624 GCATCACTGTACTCCAGCCTGGG - Intronic
1136129832 16:28212545-28212567 GTGTTACCGCACTCCAGCCTGGG - Intergenic
1136169572 16:28480441-28480463 GCAGTACTGTACTCCAGCCTGGG - Intronic
1136238311 16:28928475-28928497 GCATTACTGTACTCCAGCCTGGG + Intronic
1136356905 16:29750292-29750314 GCGTCACCGCACTCCAGCCTGGG - Intergenic
1136373777 16:29852552-29852574 GCATCACTGTACTCCAGCCTGGG + Intergenic
1136382464 16:29901843-29901865 GCTTTTCCGTTCTCCTGCCTGGG + Exonic
1136387617 16:29939464-29939486 GCACTACTGTACTCCAGCCTGGG - Intergenic
1136472206 16:30488658-30488680 GCACTACCGCACTCCAGCCTCGG + Intronic
1136477631 16:30523487-30523509 GCATCACTGCAATCCAGCCTGGG + Intergenic
1136483933 16:30559066-30559088 GCCTCACCGCACTCCAGCCTGGG + Intergenic
1136958402 16:34813283-34813305 GCGTCACCGCACTCCAGCCTGGG + Intergenic
1137006408 16:35278153-35278175 GCATCACTGCAATCCAGCCTTGG + Intergenic
1137460645 16:48659670-48659692 GCACTACTGTACTCCAGCCTAGG - Intergenic
1137630461 16:49939746-49939768 GCACTACTGTACTCCAGCCTGGG + Intergenic
1137648849 16:50101149-50101171 GCACTACTGTACTCCAGCCTGGG - Intronic
1137728720 16:50674290-50674312 GCATCACTGTACTCCAGCCTGGG - Intronic
1137978420 16:53050158-53050180 GCTCCACCCTACTCCAGCCTGGG + Intergenic
1138282256 16:55780923-55780945 GCATTGCCGTAATCCAGGCAAGG + Intergenic
1138488614 16:57363033-57363055 GCTCCACTGTACTCCAGCCTAGG - Intronic
1138559324 16:57791185-57791207 GCACCACTGTAATCCAGCCTGGG + Intronic
1138608212 16:58102467-58102489 GCTCCACTGTACTCCAGCCTGGG - Intergenic
1138665311 16:58562138-58562160 GCACTACTGTACTCCAGCCTGGG + Intronic
1139051277 16:63127733-63127755 GCGTCACTGTACTCCAGCCTGGG + Intergenic
1139111931 16:63902873-63902895 GCATTACTGTACTCCAGCCTGGG - Intergenic
1139444315 16:66987493-66987515 GCGTCACTGTACTCCAGCCTGGG - Intergenic
1139501048 16:67366193-67366215 ACTGTACTGTACTCCAGCCTGGG - Intronic
1139646242 16:68333034-68333056 GCATCACTGTACTCCAGCCTAGG - Intronic
1139723597 16:68877423-68877445 GCACCACCGTATTCCAGCCTGGG + Intronic
1139745216 16:69068754-69068776 GCGTCACCGCACTCCAGCCTGGG - Intronic
1139931207 16:70528205-70528227 GCACTACTGTACTCCAGCCTGGG - Intronic
1140364574 16:74371350-74371372 GCGCCACCGTACTCCAGCCTGGG - Intergenic
1140440880 16:74986574-74986596 ACATTACTGTACTCCAGCCTGGG + Intronic
1140494235 16:75369793-75369815 GCTTCACTGCACTCCAGCCTGGG - Intronic
1140545044 16:75799717-75799739 GCTTCACTGCACTCCAGCCTGGG - Intergenic
1140680413 16:77379529-77379551 GCTCCACTGTACTCCAGCCTGGG - Intronic
1140860972 16:79017385-79017407 GCTTCACTGCACTCCAGCCTGGG + Intronic
1141076843 16:81014275-81014297 GCGTTACTGCACTCCAGCCTGGG - Intronic
1141102411 16:81207789-81207811 GCATCACTGTACTCCAGCCTGGG - Intergenic
1141136301 16:81467927-81467949 TCATCACCGTACTCCAGCCTGGG - Intronic
1141304066 16:82844680-82844702 GCATCACCGCACTCCAGCCTGGG - Intronic
1141493325 16:84389761-84389783 GCGCCACCGTACTCCAGCCTGGG - Intronic
1141640892 16:85340596-85340618 GCGTCACTGTACTCCAGCCTGGG + Intergenic
1141656508 16:85419561-85419583 GCATCACTGTACTCCAGCCTGGG + Intergenic
1141666508 16:85468357-85468379 GCGTCACCGCACTCCAGCCTGGG - Intergenic
1142018735 16:87766595-87766617 GCGCTACCGCACTCCAGCCTGGG - Intergenic
1142069684 16:88084386-88084408 GCGCCACCGTACTCCAGCCTGGG + Intronic
1142170429 16:88619229-88619251 GCACCACCGTACTCCAGCCTGGG + Intronic
1142310727 16:89311938-89311960 GCATCACCGCACTCCAGCCTGGG - Intronic
1142379752 16:89724602-89724624 GCACAACCGTACTCCAGCCTGGG + Intronic
1142571178 17:875632-875654 GCACCACCGTACTCCAGCCTGGG - Intronic
1142598903 17:1043567-1043589 GCGCTACTGTACTCCAGCCTGGG - Intronic
1142659767 17:1419849-1419871 GCACCACCGTACTCCAGCCTGGG - Intergenic
1142719421 17:1766511-1766533 GCTCCACTGTACTCCAGCCTGGG + Intronic
1142751130 17:1988462-1988484 TATTTACTGTACTCCAGCCTGGG + Intronic
1143149255 17:4797270-4797292 GCGTCACTGTACTCCAGCCTGGG + Intronic
1143553336 17:7645031-7645053 GCACCACCGTACTCCAGCCTGGG + Intergenic
1143557732 17:7672753-7672775 ACATCACTGTAATCCAGCCTGGG + Intronic
1143686428 17:8520451-8520473 GCTCCACTGTACTCCAGCCTGGG + Intronic
1143694830 17:8605700-8605722 GCATCACTGTACTCCAGCCTGGG + Intronic
1143801139 17:9381924-9381946 GCATCACTGTACTCCAGCCTGGG + Intronic
1143838394 17:9711469-9711491 GCGCTACTGTACTCCAGCCTGGG - Intronic
1143958456 17:10694391-10694413 ACTGAACTGTAATCCAGCCTGGG + Intronic
1144328217 17:14202265-14202287 GCACCACCGTACTCCAGCCTGGG - Intronic
1144524190 17:15976021-15976043 GCATCACTGTACTCCAGCCTGGG + Intergenic
1144525193 17:15983300-15983322 GCATCACTGTACTCCAGCCTGGG + Intronic
1145026132 17:19469211-19469233 GCGTCACTGTACTCCAGCCTGGG - Intergenic
1145171637 17:20662872-20662894 GCCTCACTGTATTCCAGCCTGGG + Intergenic
1145893891 17:28440141-28440163 GCTCTACTGTACTACAGCCTGGG - Intergenic
1146135826 17:30320078-30320100 GCACCACCGTACTCCAGCCTGGG - Intronic
1146335564 17:31967154-31967176 GCGTTACTGCACTCCAGCCTGGG + Intronic
1146437990 17:32869174-32869196 GCACTACCGCACTCCAGCCTGGG + Intronic
1146984449 17:37201389-37201411 GCATCACTGTACTCCAGCCTGGG + Intronic
1146991023 17:37272298-37272320 GCATCACTGTACTCCAGCCTGGG + Intronic
1147036140 17:37682566-37682588 GTGTCACCGTACTCCAGCCTGGG + Intergenic
1147260702 17:39208487-39208509 GCTTTGCAGGAAGCCAGCCTAGG - Intergenic
1147416286 17:40292590-40292612 GCGCTACTGTACTCCAGCCTGGG + Intronic
1147435609 17:40412151-40412173 GCATCACTGTACTCCAGCCTGGG + Intronic
1147478081 17:40733375-40733397 GCGCCACCGTACTCCAGCCTGGG - Intergenic
1147596160 17:41719019-41719041 GCACTACTGCAATCCAGCCTGGG - Intronic
1148112843 17:45156238-45156260 GCGCCACCGTACTCCAGCCTGGG + Intergenic
1148229411 17:45922044-45922066 GCTTCACTGCACTCCAGCCTGGG - Intronic
1148469955 17:47886826-47886848 GCTTCACTGCACTCCAGCCTGGG - Intergenic
1148512947 17:48188641-48188663 GCGCTACTGTATTCCAGCCTTGG + Intronic
1148538266 17:48458694-48458716 GCGTCACTGTACTCCAGCCTGGG - Intergenic
1149122279 17:53184406-53184428 GCACTACTGTACTCCAGCCTGGG - Intergenic
1149122694 17:53189304-53189326 GCTCCACTGTACTCCAGCCTGGG + Intergenic
1149319039 17:55466232-55466254 GCACTACTGTACTCCAGCCTGGG + Intergenic
1149492419 17:57094651-57094673 GCATTACTGCACTCCAGCCTGGG - Intronic
1149592166 17:57838245-57838267 GCTCCACTGTACTCCAGCCTGGG + Exonic
1149621592 17:58049425-58049447 GCATCACCATACTCCAGCCTGGG + Intergenic
1149724457 17:58879550-58879572 GCATCACCGCACTCCAGCCTGGG - Intronic
1149807076 17:59628699-59628721 GCACCACCGTACTCCAGCCTGGG - Intronic
1149826834 17:59836267-59836289 GCTGCACTGTACTCCAGCCTCGG - Intronic
1149832000 17:59880555-59880577 GCGCTACCGTACTCCAGCCTGGG - Intronic
1149888344 17:60363556-60363578 GCACTACTGTACTCCAGCCTTGG - Intronic
1149905192 17:60519824-60519846 GCATCACCGTACTCCAGCCTGGG - Intronic
1149999360 17:61423806-61423828 GCTGCACTGTACTCCAGCCTGGG + Intergenic
1150012024 17:61513531-61513553 GCATTATTGTACTCCAGCCTGGG - Intergenic
1150378188 17:64699660-64699682 GCTCCACTGTACTCCAGCCTGGG + Intergenic
1150381453 17:64723446-64723468 GCATCACTGTACTCCAGCCTGGG + Intergenic
1150383151 17:64736471-64736493 GCTTCACTGCACTCCAGCCTGGG + Intergenic
1150745380 17:67812540-67812562 GCATCACCGTACCCCAGCCTGGG - Intergenic
1150752718 17:67880677-67880699 ACTTTACGGCAATCCAGCCTGGG - Intronic
1150765786 17:68001215-68001237 GCACTACTGTACTCCAGCCTGGG - Intergenic
1150828116 17:68494496-68494518 GCACTACTGTACTCCAGCCTGGG + Intergenic
1150855701 17:68750643-68750665 GCTCCACTGTACTCCAGCCTGGG - Intergenic
1151043741 17:70895033-70895055 GCGTCACTGTACTCCAGCCTGGG + Intergenic
1151161625 17:72170821-72170843 GCATCACTGTACTCCAGCCTGGG + Intergenic
1151843987 17:76638417-76638439 GCTCTACTGCACTCCAGCCTGGG - Intronic
1152193745 17:78903962-78903984 GCGCCACCGTACTCCAGCCTGGG - Intronic
1152207024 17:78979706-78979728 GCATCACTGTACTCCAGCCTGGG + Intronic
1152603072 17:81274947-81274969 GCTCCACCATACTCCAGCCTGGG - Intronic
1152619175 17:81352813-81352835 GCGTCACTGTACTCCAGCCTGGG + Intergenic
1152841497 17:82571556-82571578 GCGTCACTGTACTCCAGCCTGGG + Intronic
1153017057 18:593153-593175 GCACTACTGTACTCCAGCCTGGG - Intergenic
1153190395 18:2531608-2531630 GCTGTACTGCACTCCAGCCTGGG + Intergenic
1153241904 18:3038575-3038597 GCGTCACCGCACTCCAGCCTGGG + Intergenic
1153289103 18:3482952-3482974 GCACTACTGTACTCCAGCCTGGG - Intergenic
1153365954 18:4256355-4256377 GCATTACTGCATTCCAGCCTGGG + Intronic
1153701139 18:7694467-7694489 GCACTACCGCAGTCCAGCCTGGG - Intronic
1154224980 18:12495005-12495027 GCATCACCGCACTCCAGCCTGGG + Intronic
1154311510 18:13270320-13270342 GCTTCACTGTAATCTAGCCTGGG + Intronic
1154380022 18:13840874-13840896 GCCTCACTGTACTCCAGCCTGGG - Intergenic
1154443081 18:14410298-14410320 GCTCAACTGTACTCCAGCCTGGG - Intergenic
1154944366 18:21147317-21147339 GCACTACCGTACTCCAGCCTGGG - Intergenic
1155098240 18:22580776-22580798 GCTCCACTGTAGTCCAGCCTGGG + Intergenic
1155118311 18:22792339-22792361 GCGCCACCGTACTCCAGCCTGGG - Intergenic
1155206875 18:23566339-23566361 GCATCACTGTATTCCAGCCTGGG + Intronic
1155285023 18:24279384-24279406 GCGCTACTGTACTCCAGCCTGGG + Intronic
1155588016 18:27390428-27390450 GCTCCACTGTACTCCAGCCTGGG - Intergenic
1155951590 18:31919488-31919510 GCGTCACTGTACTCCAGCCTGGG + Intronic
1156238467 18:35227869-35227891 ACTCCACTGTAATCCAGCCTGGG + Intergenic
1156262718 18:35459825-35459847 GCACCACCGTACTCCAGCCTAGG + Intronic
1156295622 18:35787469-35787491 GCACTACTGTACTCCAGCCTGGG - Intergenic
1156464402 18:37339709-37339731 GCACTACTGTACTCCAGCCTGGG + Intronic
1156761814 18:40601212-40601234 GCGCTACTGTACTCCAGCCTGGG - Intergenic
1156975938 18:43221677-43221699 GCGCTACTGTACTCCAGCCTGGG - Intergenic
1157076383 18:44472109-44472131 GCTCTGCAGTCATCCAGCCTGGG - Intergenic
1157571858 18:48717767-48717789 GCACTACTGTACTCCAGCCTGGG - Intronic
1157866328 18:51188553-51188575 GCTCTACTGCACTCCAGCCTGGG + Intronic
1157968328 18:52235681-52235703 GCATCACTGTACTCCAGCCTGGG + Intergenic
1158003369 18:52644534-52644556 GCGCCACCGTACTCCAGCCTGGG + Intronic
1158116383 18:54000779-54000801 GCGCCACCGTACTCCAGCCTGGG + Intergenic
1158135717 18:54205546-54205568 GCGTCACTGTACTCCAGCCTGGG + Intronic
1158447315 18:57532631-57532653 GCTCTGCTGTACTCCAGCCTGGG + Intergenic
1158500176 18:57993828-57993850 GCCTCACTGTACTCCAGCCTGGG + Intergenic
1158604761 18:58885809-58885831 GCATCATCGTACTCCAGCCTGGG + Intronic
1158613281 18:58962643-58962665 GCGTCACTGTACTCCAGCCTGGG - Intronic
1158693622 18:59683653-59683675 GCATCACTGTACTCCAGCCTGGG + Intronic
1158715043 18:59871246-59871268 GCATCACCGCACTCCAGCCTGGG + Intergenic
1158927625 18:62285178-62285200 GCATCACTGTACTCCAGCCTGGG - Intronic
1159035217 18:63270858-63270880 GCACCACCGTACTCCAGCCTGGG - Intronic
1159046825 18:63376592-63376614 GCATCACTGTACTCCAGCCTAGG - Intergenic
1159309046 18:66684225-66684247 GCACCACTGTAATCCAGCCTGGG + Intergenic
1159341580 18:67140976-67140998 GCATCACTGTACTCCAGCCTGGG - Intergenic
1159420916 18:68218276-68218298 GCTCCACTGCAATCCAGCCTGGG + Intergenic
1160196622 18:76760410-76760432 GCTCCACCACAATCCAGCCTGGG - Intergenic
1160341517 18:78093195-78093217 GCACTACTGTACTCCAGCCTGGG - Intergenic
1160787961 19:910280-910302 GCACTACTGTACTCCAGCCTGGG + Intronic
1160884113 19:1337040-1337062 GTTCTACTGTACTCCAGCCTGGG - Intergenic
1160999309 19:1901690-1901712 GCATTACTGCACTCCAGCCTGGG - Intergenic
1161025376 19:2034365-2034387 GCACCACCGTACTCCAGCCTGGG - Intronic
1161130241 19:2584399-2584421 GCATCACTGTACTCCAGCCTAGG + Intronic
1161164207 19:2777206-2777228 GCACTACTGTACTCCAGCCTGGG + Intronic
1161235411 19:3195746-3195768 GCGTCACTGTACTCCAGCCTGGG + Intronic
1161385566 19:3990548-3990570 GCGTCACTGTACTCCAGCCTGGG - Intergenic
1161432993 19:4244856-4244878 GCGTTACTGCACTCCAGCCTAGG + Intergenic
1161436146 19:4264348-4264370 GCATTACTGCACTCCAGCCTGGG - Intronic
1161538146 19:4832444-4832466 GCACTACCGCACTCCAGCCTAGG - Intergenic
1161789416 19:6350086-6350108 GCACTACCGCACTCCAGCCTGGG + Intergenic
1161902968 19:7133217-7133239 GCTCCACCGTACTCCAGCCTGGG + Intronic
1161938516 19:7387193-7387215 GCGCCACCGTACTCCAGCCTGGG - Intronic
1162153548 19:8661840-8661862 GCGCCACTGTAATCCAGCCTGGG + Intergenic
1162205372 19:9051968-9051990 GCACCACTGTAATCCAGCCTGGG + Intergenic
1162444705 19:10715386-10715408 GCACTACTGTACTCCAGCCTGGG + Intergenic
1162451898 19:10760074-10760096 GCATCACTGTACTCCAGCCTGGG - Intronic
1162469157 19:10861939-10861961 GCGTCACCGCACTCCAGCCTGGG - Intronic
1162472810 19:10882582-10882604 GCTCCACTGTATTCCAGCCTGGG - Intronic
1162542006 19:11302759-11302781 CCCTTACCGCACTCCAGCCTGGG - Intronic
1162569290 19:11461638-11461660 GCATCACTGTACTCCAGCCTGGG - Intronic
1162641288 19:12012299-12012321 GCATCACTGTACTCCAGCCTGGG + Intergenic
1162717950 19:12645695-12645717 GCTCCACTGTACTCCAGCCTGGG - Intronic
1162845957 19:13392787-13392809 GCACTACTGTACTCCAGCCTGGG - Intronic
1162868705 19:13569276-13569298 ACATCACCGTACTCCAGCCTGGG - Intronic
1162871131 19:13587594-13587616 GCGCCACCGTACTCCAGCCTGGG + Intronic
1162902081 19:13801098-13801120 GCACCACCGTACTCCAGCCTGGG + Intronic
1162912477 19:13855949-13855971 CTTTTACTGTACTCCAGCCTGGG + Intergenic
1162921403 19:13905463-13905485 GCTCTACTGCACTCCAGCCTGGG + Intronic
1163096997 19:15065892-15065914 GCACTACTGTACTCCAGCCTGGG + Intergenic
1163261716 19:16194726-16194748 GCATCACTGTACTCCAGCCTGGG - Intergenic
1163402737 19:17104011-17104033 GCTTCACTGCACTCCAGCCTGGG + Intronic
1163456927 19:17412307-17412329 GCATTACTGCACTCCAGCCTGGG - Intronic
1163470633 19:17495013-17495035 GCTCTATTGTACTCCAGCCTGGG - Intronic
1163483685 19:17573937-17573959 GCTTCACTGCACTCCAGCCTGGG + Intronic
1163656207 19:18546580-18546602 ACGTCACCGTACTCCAGCCTGGG + Intergenic
1163737203 19:18988738-18988760 GCATCACAGTACTCCAGCCTGGG - Intergenic
1163910913 19:20191422-20191444 GCTCTACTGCACTCCAGCCTGGG + Intronic
1163951309 19:20589816-20589838 GCATTACTGAACTCCAGCCTGGG + Intronic
1164223396 19:23218315-23218337 GCTCCACCGCATTCCAGCCTGGG - Intergenic
1164323827 19:24175032-24175054 GCATCACTGTACTCCAGCCTGGG - Intergenic
1164534190 19:29072597-29072619 ACTGTACTGTACTCCAGCCTGGG + Intergenic
1164617632 19:29676357-29676379 GCATTACTGCACTCCAGCCTGGG - Intergenic
1164655657 19:29919549-29919571 GCTTCACTGCACTCCAGCCTGGG - Intergenic
1164788325 19:30955428-30955450 GCATTACCACACTCCAGCCTGGG + Intergenic
1164877847 19:31705068-31705090 GCATTACTGGACTCCAGCCTGGG + Intergenic
1165049247 19:33131253-33131275 GCGCTACTGCAATCCAGCCTGGG + Intergenic
1165059367 19:33197582-33197604 GCTCCACCGTGCTCCAGCCTGGG + Intronic
1165296225 19:34928163-34928185 GCACCACCGCAATCCAGCCTGGG + Intronic
1165557226 19:36644636-36644658 GCGCCACCGTACTCCAGCCTGGG - Intronic
1165589162 19:36951716-36951738 GCACCACCGTACTCCAGCCTGGG - Exonic
1165592781 19:36985563-36985585 GCATTACTGCACTCCAGCCTGGG - Intronic
1165798303 19:38532162-38532184 GCGCCACCGTACTCCAGCCTGGG - Intronic
1165851802 19:38853994-38854016 GCTCCACTGTACTCCAGCCTGGG + Intergenic
1165873129 19:38987288-38987310 GCACTACTGTACTCCAGCCTGGG - Intergenic
1165876558 19:39011869-39011891 GCGTCACTGTACTCCAGCCTGGG - Intronic
1166229223 19:41415984-41416006 GCGCCACCGTACTCCAGCCTGGG - Intronic
1166542813 19:43616852-43616874 GCGCTACTGTACTCCAGCCTGGG - Intronic
1166559642 19:43723788-43723810 CCGCTACCGTACTCCAGCCTGGG - Intergenic
1166658772 19:44631222-44631244 GCTCTACTGCACTCCAGCCTGGG + Intronic
1166693152 19:44836394-44836416 GCATTACTGTACTCCAGGCTGGG + Intergenic
1166701224 19:44882822-44882844 GCATCACTGTATTCCAGCCTCGG - Intronic
1166724621 19:45019103-45019125 GCGTCACTGTATTCCAGCCTGGG - Intronic
1166769089 19:45269894-45269916 GCATCACTGTACTCCAGCCTGGG - Intronic
1166865215 19:45831874-45831896 GCACCACCGTACTCCAGCCTGGG - Intronic
1166907958 19:46127307-46127329 GCACCACTGTAATCCAGCCTGGG + Intergenic
1166968438 19:46545411-46545433 GCACTACTGTACTCCAGCCTGGG + Intronic
1167044902 19:47044021-47044043 GCTGTACTGCACTCCAGCCTGGG + Intronic
1167086638 19:47314438-47314460 GCTTCACTATACTCCAGCCTGGG - Intronic
1167111842 19:47467012-47467034 GCGCTACTGTACTCCAGCCTGGG + Intronic
1167240439 19:48340167-48340189 GCATCACTGTATTCCAGCCTGGG - Intronic
1167342674 19:48925134-48925156 GCGTCATCGTACTCCAGCCTGGG - Intergenic
1167558689 19:50211943-50211965 GCGCTACTGTACTCCAGCCTGGG + Intronic
1167750589 19:51377299-51377321 GCACCACCGTACTCCAGCCTGGG + Intergenic
1167843057 19:52138100-52138122 ATTTTACCGCACTCCAGCCTGGG + Intronic
1167917993 19:52757829-52757851 GCATTACCGCACTGCAGCCTGGG - Intergenic
1168014642 19:53562645-53562667 GCTCCACTGTACTCCAGCCTGGG + Intronic
1168070909 19:53951098-53951120 GCGCTACTGTACTCCAGCCTGGG + Intergenic
1168157777 19:54486219-54486241 GCGCCACCGTACTCCAGCCTGGG - Intergenic
1168226061 19:54996162-54996184 GCGTTACCACACTCCAGCCTGGG + Intronic
1168526418 19:57092035-57092057 GCATTACCGCACTCCAGCCCGGG + Intergenic
1168607406 19:57770891-57770913 GCGTCACCGCAACCCAGCCTGGG - Intronic
925116226 2:1380349-1380371 ACTTTACTGCACTCCAGCCTGGG + Intronic
925400048 2:3566089-3566111 GCACTACTGTACTCCAGCCTGGG + Intergenic
925937300 2:8777339-8777361 GCCTTACTGTACTCCAGCCTGGG - Intronic
925938665 2:8793451-8793473 GCATCACTGTACTCCAGCCTGGG + Intronic
927145007 2:20158328-20158350 GCACTACTGTACTCCAGCCTGGG - Intergenic
927440952 2:23117356-23117378 GCACCACTGTAATCCAGCCTGGG - Intergenic
927753663 2:25691732-25691754 GCGCTACCGCACTCCAGCCTGGG - Intergenic
927764870 2:25797400-25797422 GCTCCACTGTACTCCAGCCTGGG + Intronic
927823422 2:26289205-26289227 GCGTCACTGTACTCCAGCCTGGG + Intronic
927870812 2:26622316-26622338 GCATCACTGTACTCCAGCCTGGG + Intronic
927976816 2:27344940-27344962 GTGTTACCATACTCCAGCCTGGG + Intronic
928010588 2:27603967-27603989 GCTCTACAGCACTCCAGCCTGGG - Intronic
928100415 2:28434201-28434223 GCATGACCGAACTCCAGCCTCGG - Intergenic
928116717 2:28550469-28550491 GCTTTAAAATAATCCAGGCTGGG - Intronic
928579527 2:32692931-32692953 GCACTACTGTACTCCAGCCTGGG + Intronic
929106332 2:38369398-38369420 GCTCTACTGCACTCCAGCCTGGG + Intronic
929128830 2:38546053-38546075 GCTGTACTGCACTCCAGCCTGGG + Intergenic
929159529 2:38817738-38817760 GCCCTACTGTACTCCAGCCTAGG - Intronic
929434498 2:41917559-41917581 GTGTTACCGCACTCCAGCCTGGG + Intergenic
929517045 2:42612816-42612838 GCACTACTGTACTCCAGCCTGGG + Intronic
929567226 2:42996897-42996919 GCGCCACTGTAATCCAGCCTGGG - Intergenic
929630356 2:43453935-43453957 GCTTTACTGCACTCCAGCCTGGG - Intronic
929710027 2:44257263-44257285 GCACTACCGCACTCCAGCCTGGG + Intergenic
929790751 2:45020884-45020906 GCATTACTGCACTCCAGCCTGGG - Intergenic
930074628 2:47396639-47396661 GCTCCACTGCAATCCAGCCTAGG + Intergenic
930121131 2:47761802-47761824 GCTGTACTGCACTCCAGCCTGGG - Intronic
930123726 2:47780652-47780674 GCGTCACTGTACTCCAGCCTGGG + Intronic
930125111 2:47789863-47789885 ACTGTACTGTACTCCAGCCTGGG - Intronic
930209471 2:48619425-48619447 GTGCTACCGTACTCCAGCCTGGG + Intronic
930617006 2:53603972-53603994 GCATCACTGTACTCCAGCCTAGG + Intronic
930669594 2:54134248-54134270 GCATCACTGTATTCCAGCCTGGG + Intronic
931357439 2:61549470-61549492 GCGCCACCGTACTCCAGCCTGGG + Intergenic
931374684 2:61696458-61696480 GCTTCACTGCACTCCAGCCTGGG + Intergenic
931385478 2:61794283-61794305 GCATCACTGTACTCCAGCCTGGG - Intergenic
931416560 2:62086896-62086918 GCACTACCGCACTCCAGCCTGGG - Intronic
931553429 2:63472629-63472651 GCACTACTGTACTCCAGCCTGGG - Intronic
931650753 2:64466649-64466671 GCATTCCTGTACTCCAGCCTGGG + Intergenic
931725552 2:65107106-65107128 GCTTCACTGCACTCCAGCCTGGG - Intronic
932060588 2:68494233-68494255 GCACCACTGTAATCCAGCCTAGG + Intronic
932155950 2:69417607-69417629 GCACTACTGTATTCCAGCCTGGG + Intronic
932184076 2:69676848-69676870 GCATCACTGTACTCCAGCCTGGG + Intronic
932226260 2:70043373-70043395 GCTCTACTGCACTCCAGCCTGGG + Intergenic
932253574 2:70265243-70265265 GCACCACCGTACTCCAGCCTGGG - Intronic
932261896 2:70333960-70333982 GCGCTACTGTACTCCAGCCTGGG - Intergenic
932506886 2:72242773-72242795 GCACTACTGTACTCCAGCCTGGG - Intronic
933541192 2:83644849-83644871 GCATTACTGTACTCCAGCATGGG - Intergenic
933671350 2:85010424-85010446 GCCTCACTGTACTCCAGCCTGGG + Intronic
933939188 2:87231454-87231476 GCGTCACTGTACTCCAGCCTGGG + Intergenic
934076400 2:88432215-88432237 GCGTCACCGCACTCCAGCCTGGG + Intergenic
934570117 2:95365202-95365224 ATGTCACCGTAATCCAGCCTGGG - Intronic
934909414 2:98237131-98237153 GCGTCACCGCATTCCAGCCTGGG + Intronic
935061472 2:99611842-99611864 GCGTTACTGCACTCCAGCCTGGG + Intronic
935159422 2:100516550-100516572 GCTCCACTGTACTCCAGCCTGGG - Intergenic
935163638 2:100550778-100550800 GCATCACTGTACTCCAGCCTGGG - Intergenic
935284630 2:101553312-101553334 GCACTACTGTACTCCAGCCTGGG - Intergenic
935471631 2:103467366-103467388 GCACTACTGTACTCCAGCCTGGG - Intergenic
935489953 2:103706722-103706744 GTTTCACTGTACTCCAGCCTGGG - Intergenic
935790790 2:106588075-106588097 GCGTCACTGTACTCCAGCCTGGG + Intergenic
936033374 2:109089561-109089583 GCACTACCGCACTCCAGCCTGGG + Intergenic
936141296 2:109943933-109943955 GCTCTACTGCACTCCAGCCTGGG + Intergenic
936141522 2:109946148-109946170 GCACCACTGTAATCCAGCCTGGG - Intergenic
936177985 2:110241882-110241904 GCTCTACTGCACTCCAGCCTGGG + Intergenic
936178211 2:110244096-110244118 GCACCACTGTAATCCAGCCTGGG - Intergenic
936203172 2:110425335-110425357 GCACCACTGTAATCCAGCCTGGG + Intronic
936203397 2:110427549-110427571 GCTCTACTGCACTCCAGCCTGGG - Intronic
936353946 2:111734321-111734343 GCGTCACTGTACTCCAGCCTGGG - Intergenic
936372045 2:111910220-111910242 GCCTTACTGCACTCCAGCCTGGG + Intronic
936459366 2:112701389-112701411 GCTCCACCGCACTCCAGCCTGGG - Intergenic
936514331 2:113172464-113172486 GCATCACTGTACTCCAGCCTGGG + Intronic
936584326 2:113740667-113740689 GCGCCACCGTACTCCAGCCTGGG - Intronic
936596131 2:113849908-113849930 GCGCCACCGTACTCCAGCCTGGG + Intergenic
937011591 2:118567578-118567600 GCACTACTGTACTCCAGCCTGGG + Intergenic
937169196 2:119848641-119848663 GCATCACTGCAATCCAGCCTGGG - Intronic
937432102 2:121847655-121847677 GCACTACTGTAATCCAGCCTGGG - Intergenic
937721374 2:125100459-125100481 GCACTACTGTATTCCAGCCTGGG + Intergenic
937804481 2:126123004-126123026 GCTTCACTGCACTCCAGCCTGGG - Intergenic
938228707 2:129639455-129639477 GCTTTTCCATCATCCAGTCTTGG + Intergenic
938897762 2:135769043-135769065 GCGTTACTGCATTCCAGCCTGGG - Intronic
940537936 2:154970323-154970345 GCATCACTGTACTCCAGCCTGGG + Intergenic
940789032 2:158012308-158012330 GTTTCACTGTACTCCAGCCTGGG - Intronic
940833219 2:158491836-158491858 GCTTCACTGTACTCCAGCCTGGG - Intronic
941212751 2:162662218-162662240 GCGTCACTGTACTCCAGCCTGGG + Intronic
941880841 2:170478609-170478631 GCATTACTGTACTCCAGCCTGGG - Intronic
941946816 2:171108012-171108034 GCGTCACCGTACTCCAGCCTGGG + Intronic
941999788 2:171634378-171634400 GCATTTCTGTATTCCAGCCTAGG + Intergenic
942334248 2:174864820-174864842 GCACTACTGTAGTCCAGCCTGGG + Intronic
942865206 2:180665450-180665472 GCATTACTGCACTCCAGCCTGGG - Intergenic
943024702 2:182613518-182613540 GCTCCACTGTACTCCAGCCTGGG + Intergenic
943440202 2:187918450-187918472 GCTCCACTGTACTCCAGCCTGGG - Intergenic
943622439 2:190164485-190164507 GCATCACTGTACTCCAGCCTGGG + Intronic
943644392 2:190393486-190393508 GCTATACTGCACTCCAGCCTGGG - Intergenic
943728315 2:191274948-191274970 GCGCCACTGTAATCCAGCCTGGG - Intronic
944158936 2:196639061-196639083 GCACCACCGTAATCCACCCTTGG + Intergenic
944188154 2:196972244-196972266 GCACTACCATACTCCAGCCTGGG - Intronic
944419442 2:199513851-199513873 GCTCTACTGCACTCCAGCCTGGG - Intergenic
944444665 2:199777248-199777270 GCGTTGCTGTACTCCAGCCTGGG + Intronic
944551269 2:200846685-200846707 GCACTACTGTACTCCAGCCTGGG - Intergenic
944564785 2:200978516-200978538 GCACTACTGTACTCCAGCCTAGG - Exonic
944590810 2:201216324-201216346 GCATTACCGCATTCTAGCCTGGG + Intronic
944644024 2:201760266-201760288 GCATTACTGCACTCCAGCCTGGG + Intronic
944750119 2:202700727-202700749 GCATTACTGCACTCCAGCCTAGG - Intronic
944794759 2:203171560-203171582 GCTTCACTGCACTCCAGCCTGGG + Intronic
945003191 2:205374277-205374299 GCTCCACTGTATTCCAGCCTGGG - Intronic
945476745 2:210292109-210292131 GCGTTACTGCACTCCAGCCTGGG - Intronic
945705312 2:213223476-213223498 GCAATACCGCACTCCAGCCTAGG - Intergenic
945879021 2:215307526-215307548 GCTTCACTGCACTCCAGCCTGGG + Intergenic
946016182 2:216605921-216605943 GCTCTACTGCACTCCAGCCTGGG - Intergenic
946229783 2:218284119-218284141 GCGCCACCGTACTCCAGCCTGGG + Intronic
946231782 2:218295886-218295908 GCACTACTGTACTCCAGCCTGGG - Intronic
946251098 2:218412998-218413020 GTGCTACCGTACTCCAGCCTGGG + Intergenic
946377907 2:219324946-219324968 GCACTACTGTACTCCAGCCTGGG + Intergenic
946390543 2:219413538-219413560 GCACCACTGTAATCCAGCCTGGG + Intergenic
946514072 2:220392596-220392618 GCGTTACTGCACTCCAGCCTGGG - Intergenic
946850963 2:223907015-223907037 GCATCACTGTACTCCAGCCTGGG - Intronic
946852085 2:223917614-223917636 GCTCCACCGCACTCCAGCCTGGG - Intronic
946957021 2:224941799-224941821 TCATCACTGTAATCCAGCCTGGG + Intronic
947115374 2:226764498-226764520 ACTTTACCACATTCCAGCCTGGG + Intronic
947143451 2:227041596-227041618 GCGTCACTGTACTCCAGCCTGGG + Intronic
947199633 2:227603263-227603285 GCATTATTGTACTCCAGCCTGGG - Intergenic
947428801 2:230007642-230007664 GCTTCACTGCACTCCAGCCTGGG - Intronic
948076076 2:235166197-235166219 ACTCCACCGTACTCCAGCCTGGG + Intergenic
948217659 2:236243867-236243889 ACATCACCGTACTCCAGCCTGGG - Intronic
948832999 2:240607932-240607954 GCATCACTGTACTCCAGCCTGGG - Intronic
1168776789 20:454712-454734 GCTTCACTGCACTCCAGCCTGGG - Intronic
1169108375 20:3016695-3016717 GCACTACTGTACTCCAGCCTGGG + Intronic
1169144589 20:3244112-3244134 GCGCCACTGTAATCCAGCCTGGG - Intergenic
1169170691 20:3462525-3462547 GCTCCACTGCAATCCAGCCTGGG - Intergenic
1169262109 20:4146785-4146807 GCATCACTGTATTCCAGCCTGGG + Intronic
1169360570 20:4945351-4945373 GCTTGACTGTACTCCAACCTGGG - Intronic
1169443879 20:5655532-5655554 GCATCACCGCACTCCAGCCTGGG + Intergenic
1169469935 20:5875667-5875689 GCACCACCGCAATCCAGCCTGGG + Intergenic
1169494146 20:6097855-6097877 GCACTACTGTACTCCAGCCTAGG - Intronic
1169666905 20:8047770-8047792 GCCTCACCGCACTCCAGCCTGGG - Intergenic
1170191777 20:13651775-13651797 GCACCACTGTAATCCAGCCTAGG + Intergenic
1170203320 20:13768537-13768559 GCACCACCGTACTCCAGCCTAGG + Intronic
1170228213 20:14015533-14015555 GCACTACTGTACTCCAGCCTGGG + Intronic
1170675947 20:18481282-18481304 GCACTACTGTACTCCAGCCTGGG - Intronic
1171116045 20:22525674-22525696 GCATCACTGTACTCCAGCCTGGG + Intergenic
1171150961 20:22826189-22826211 GCTTCACTGCACTCCAGCCTGGG - Intergenic
1172036340 20:32013482-32013504 GCAACACCGTACTCCAGCCTGGG - Intronic
1172037909 20:32023008-32023030 GCATCACTGTACTCCAGCCTGGG - Intronic
1172044203 20:32068253-32068275 GCACCACCGTACTCCAGCCTGGG + Intronic
1172259280 20:33548286-33548308 GCGTGACTGCAATCCAGCCTGGG - Intronic
1172262920 20:33584306-33584328 GCATCACTGTATTCCAGCCTGGG - Intronic
1172531568 20:35634549-35634571 GCGCCACCGTACTCCAGCCTGGG + Intronic
1172558052 20:35860281-35860303 GCATCACTGTACTCCAGCCTAGG - Intronic
1172671876 20:36640254-36640276 GCTTCACTGCACTCCAGCCTGGG + Intronic
1172800029 20:37569421-37569443 GCATTGCTGCAATCCAGCCTGGG - Intergenic
1172804700 20:37603513-37603535 GCATCACCGCACTCCAGCCTGGG - Intergenic
1172889121 20:38251606-38251628 GCATCACTGTACTCCAGCCTGGG - Intronic
1172942141 20:38661525-38661547 GCTCCACTGTACTCCAGCCTGGG - Intergenic
1173514380 20:43654710-43654732 GCATCACTGTACTCCAGCCTGGG + Intergenic
1173603909 20:44315957-44315979 CCGCTACCGTACTCCAGCCTGGG - Intergenic
1173631130 20:44516433-44516455 GCGTTACTGCACTCCAGCCTGGG - Intronic
1173734649 20:45350987-45351009 GCGTCACCGCACTCCAGCCTGGG - Intergenic
1173777993 20:45727549-45727571 ACTTTACAGTGATACAGCCTGGG - Intergenic
1173791705 20:45832265-45832287 GCATCACTGTACTCCAGCCTGGG + Intronic
1173832215 20:46098027-46098049 GCGTCACTGTACTCCAGCCTGGG - Intergenic
1173915289 20:46703210-46703232 GCTCTACTGTACTCCAGCCTCGG + Intergenic
1174099620 20:48117200-48117222 GCACCACCGTACTCCAGCCTGGG + Intergenic
1174210425 20:48873924-48873946 GCCCCACTGTAATCCAGCCTGGG - Intergenic
1174227050 20:49009405-49009427 GCTCTACTGCATTCCAGCCTGGG + Intronic
1174244290 20:49164724-49164746 ACACTACCGTACTCCAGCCTAGG + Intronic
1174323471 20:49760613-49760635 GCTCCACTGCAATCCAGCCTGGG + Intergenic
1174455708 20:50647275-50647297 GCATCACTGTACTCCAGCCTAGG + Intronic
1174753482 20:53135636-53135658 ACTGTACTGTACTCCAGCCTGGG - Intronic
1174773710 20:53324418-53324440 GCATCACTGTACTCCAGCCTGGG - Intronic
1174805663 20:53602300-53602322 GCATCACCATACTCCAGCCTGGG + Intronic
1174823736 20:53750071-53750093 GCACTACTGTACTCCAGCCTGGG - Intergenic
1175070944 20:56333310-56333332 GCATGACCGCACTCCAGCCTGGG - Intergenic
1175867351 20:62186569-62186591 ACGTTACCGCACTCCAGCCTGGG - Intronic
1175937487 20:62520510-62520532 GCGTTACTGCACTCCAGCCTGGG + Intergenic
1176142439 20:63550702-63550724 GCGCCACCGTACTCCAGCCTGGG + Intronic
1176211569 20:63925712-63925734 GCGTCACCGCACTCCAGCCTGGG + Intronic
1176409554 21:6440803-6440825 GCATCACCGTGCTCCAGCCTAGG - Intergenic
1176453013 21:6880902-6880924 GCTCGACTGTACTCCAGCCTGGG + Intergenic
1176719767 21:10383584-10383606 GCACTACTGTACTCCAGCCTGGG + Intergenic
1176733152 21:10520448-10520470 GCATCACCGCACTCCAGCCTGGG - Intergenic
1176831186 21:13745950-13745972 GCTCGACTGTACTCCAGCCTGGG + Intergenic
1177145111 21:17399020-17399042 GCATCACTGTACTCCAGCCTGGG - Intergenic
1177419782 21:20841216-20841238 GCACTACTGTACTCCAGCCTGGG + Intergenic
1177649785 21:23945938-23945960 GCTTCACTGCACTCCAGCCTGGG - Intergenic
1177961810 21:27676069-27676091 GCGCTACCGCACTCCAGCCTGGG + Intergenic
1178168388 21:30008774-30008796 GCGCTACTATAATCCAGCCTGGG + Intergenic
1178181665 21:30168827-30168849 GCTTTACTGCACTCCAGTCTGGG + Intergenic
1178401727 21:32292218-32292240 GCTTCACAGTAATCCAGGGTTGG + Intronic
1178513588 21:33228108-33228130 GCGCTACCGCACTCCAGCCTGGG - Intergenic
1178548399 21:33513525-33513547 GCACTACTGTACTCCAGCCTGGG + Intronic
1178593942 21:33936065-33936087 GCACCACCGTACTCCAGCCTGGG - Intergenic
1179662471 21:42885735-42885757 GTATTACTGTACTCCAGCCTGGG - Intronic
1179685047 21:43049125-43049147 GCATCACCGTGCTCCAGCCTAGG - Intergenic
1180206116 21:46261688-46261710 GCGTCACTGTACTCCAGCCTGGG + Intronic
1180207533 21:46270759-46270781 GCATCACTGTACTCCAGCCTGGG + Intronic
1180887355 22:19256198-19256220 GCTCCACTGTACTCCAGCCTGGG - Intronic
1180903679 22:19393398-19393420 GCGCCACCGTACTCCAGCCTGGG - Intronic
1180906361 22:19414986-19415008 GCGTTACTGCACTCCAGCCTGGG - Intronic
1180933664 22:19610290-19610312 GCTCCACTGTACTCCAGCCTGGG + Intergenic
1181470842 22:23138517-23138539 GTGTCACCGTACTCCAGCCTGGG + Intronic
1181718841 22:24757793-24757815 GCATCACTGTACTCCAGCCTGGG + Intronic
1181727821 22:24823865-24823887 GCGTCACTGTACTCCAGCCTGGG + Intronic
1181806257 22:25376120-25376142 GCATTACTGCACTCCAGCCTGGG - Intronic
1181880874 22:25978902-25978924 GCTTCACTGCACTCCAGCCTGGG + Intronic
1181936162 22:26440372-26440394 GCATCACCGCACTCCAGCCTGGG - Intronic
1182030331 22:27154358-27154380 GCATCACTGTACTCCAGCCTGGG + Intergenic
1182069427 22:27453091-27453113 GCATGACTGCAATCCAGCCTGGG + Intergenic
1182136821 22:27912938-27912960 GCAATACTGTACTCCAGCCTGGG + Intronic
1182170789 22:28226966-28226988 GCTCTACTGCACTCCAGCCTGGG - Intronic
1182242163 22:28924692-28924714 GCATCACAGTACTCCAGCCTGGG + Intronic
1182325135 22:29506905-29506927 CCTGTACTGTACTCCAGCCTGGG - Exonic
1182326608 22:29518074-29518096 GCATCACTGTATTCCAGCCTGGG - Intronic
1182513915 22:30841120-30841142 GCATCACTGTACTCCAGCCTGGG + Intronic
1182587740 22:31355046-31355068 GCATTACTGCACTCCAGCCTGGG - Intergenic
1182611238 22:31549245-31549267 ACATTACTGTACTCCAGCCTAGG + Intronic
1182641579 22:31772184-31772206 GCATTATTGTACTCCAGCCTGGG + Intronic
1182813255 22:33135795-33135817 GCTCTACCGCACTCCAGCCTGGG + Intergenic
1182892065 22:33827325-33827347 GCACTACTGTACTCCAGCCTGGG + Intronic
1182897464 22:33870609-33870631 GCGCTACTGTACTCCAGCCTGGG - Intronic
1183053891 22:35289095-35289117 GCGCTACTGTACTCCAGCCTGGG + Intronic
1183085078 22:35481784-35481806 GCTCCACTGTACTCCAGCCTGGG - Intergenic
1183223867 22:36535859-36535881 GCTCTACTGCACTCCAGCCTGGG + Intergenic
1183291547 22:37004728-37004750 GCACTACTGTACTCCAGCCTGGG - Intronic
1183397154 22:37578324-37578346 GCACTACTGTACTCCAGCCTGGG - Intronic
1183419718 22:37704338-37704360 GCATTACTGTATTTCAGCCTGGG + Intronic
1183488498 22:38103818-38103840 GCATCACTGTACTCCAGCCTCGG + Intronic
1183499008 22:38167183-38167205 GCGTCACTGTACTCCAGCCTGGG + Intronic
1183692303 22:39397479-39397501 GCGCCACCGTACTCCAGCCTGGG - Intergenic
1183770693 22:39922997-39923019 GCTCCACTGTACTCCAGCCTGGG + Intronic
1183839574 22:40486928-40486950 GCATCACTGCAATCCAGCCTGGG + Intronic
1184026800 22:41863922-41863944 GCGTCACTGTACTCCAGCCTAGG - Intronic
1184121814 22:42455694-42455716 GCTCCACTGTACTCCAGCCTGGG + Intergenic
1184185784 22:42864269-42864291 GCATCACTGTACTCCAGCCTGGG + Intronic
1184539421 22:45110456-45110478 GCATCACTGTACTCCAGCCTGGG - Intergenic
1184558295 22:45245875-45245897 GCATCACTGTACTCCAGCCTGGG - Intergenic
1184625206 22:45721870-45721892 GCTTCACTGCACTCCAGCCTGGG + Intronic
1184772961 22:46608634-46608656 GCATTACTGTACTACAGCCTGGG + Intronic
1184874736 22:47267082-47267104 GCACTACCGCACTCCAGCCTGGG - Intergenic
1185064631 22:48625070-48625092 GCTTCACTGCACTCCAGCCTGGG + Intronic
1185299273 22:50071149-50071171 GCGCCACCGTACTCCAGCCTGGG - Intronic
1185354289 22:50357534-50357556 CATTTACTGTACTCCAGCCTGGG - Intronic
1185359699 22:50398212-50398234 GCACCACCGTACTCCAGCCTGGG - Intronic
1185360127 22:50401552-50401574 GCATCACTGTACTCCAGCCTGGG - Intronic
949779870 3:7674232-7674254 GCGTCACTGTATTCCAGCCTGGG - Intronic
950325409 3:12104615-12104637 GCTCCACCGCACTCCAGCCTGGG - Intronic
950407219 3:12812264-12812286 GCGTCACCGTACTCCAGCCTGGG - Intronic
950473534 3:13201371-13201393 GCATTACTGCACTCCAGCCTGGG - Intergenic
950547898 3:13649572-13649594 GCTTCACTGCACTCCAGCCTGGG - Intergenic
950762982 3:15250330-15250352 GCTCCACTGTACTCCAGCCTGGG + Intronic
950869777 3:16218855-16218877 GTGTTACTGTACTCCAGCCTGGG - Intronic
951109688 3:18787145-18787167 GTGTTACTGTACTCCAGCCTGGG + Intergenic
951536818 3:23747450-23747472 GCATCACTGCAATCCAGCCTAGG - Intergenic
951727620 3:25777350-25777372 GCATCACCGCACTCCAGCCTGGG + Intronic
951756035 3:26092225-26092247 GCATCACTGCAATCCAGCCTGGG + Intergenic
951775407 3:26304826-26304848 GCTTCACTGCACTCCAGCCTGGG - Intergenic
952090500 3:29878994-29879016 GCTATACTGTACTCCAACCTGGG + Intronic
952326058 3:32321638-32321660 GCACCACTGTAATCCAGCCTGGG - Intronic
952798545 3:37265981-37266003 GCATTACTGTGCTCCAGCCTGGG + Intronic
953396803 3:42579556-42579578 GCATCACCGCACTCCAGCCTGGG + Intronic
953510200 3:43528914-43528936 GCATCACTGTACTCCAGCCTGGG + Intronic
953529830 3:43730546-43730568 GCACCACCGTATTCCAGCCTCGG - Intronic
953952907 3:47206150-47206172 GCACTACTGTACTCCAGCCTGGG - Intergenic
954158456 3:48701853-48701875 GCACTACTGTACTCCAGCCTGGG + Intronic
954180853 3:48880323-48880345 GCTTCACTGCACTCCAGCCTGGG - Intronic
954185448 3:48913712-48913734 GCTCCACTGTACTCCAGCCTGGG - Intergenic
954189833 3:48951003-48951025 GCTCTACTGCACTCCAGCCTGGG - Intronic
954206774 3:49065176-49065198 GCCTCACTGTACTCCAGCCTGGG - Intronic
954323881 3:49851020-49851042 GCTTTACTGCATTCCAGCCTGGG - Intronic
954554031 3:51504388-51504410 GCTTCACTGCACTCCAGCCTGGG - Intergenic
954654073 3:52183295-52183317 GCGCTACTGTACTCCAGCCTGGG - Intergenic
954733327 3:52684123-52684145 ACTTTACTGAACTCCAGCCTGGG + Intronic
954981820 3:54752901-54752923 GCGTTACTGCACTCCAGCCTGGG - Intronic
955018135 3:55091405-55091427 GCCTTACTGCACTCCAGCCTGGG + Intergenic
955217113 3:56993415-56993437 GCACTACTGTACTCCAGCCTGGG - Intronic
955277300 3:57558531-57558553 GCGCCACCGTACTCCAGCCTAGG - Intronic
955300285 3:57771570-57771592 ACTGCACCGTATTCCAGCCTGGG - Intronic
955302385 3:57794022-57794044 GAGTTACTGTATTCCAGCCTGGG + Intronic
955368269 3:58330177-58330199 GCATCACCGCATTCCAGCCTGGG - Intergenic
955668026 3:61370692-61370714 GCCCTACTGTACTCCAGCCTGGG + Intergenic
956135684 3:66096335-66096357 GCATTACTGCATTCCAGCCTGGG - Intergenic
956364904 3:68490880-68490902 GCATTACTGCACTCCAGCCTGGG - Intronic
956687754 3:71846878-71846900 GCGCTACCGTACTCCAGCCTGGG - Intergenic
957032002 3:75253165-75253187 GCATCACTGTACTCCAGCCTGGG - Intergenic
957192577 3:77028674-77028696 GCGTCACTGTACTCCAGCCTGGG + Intronic
957482329 3:80814830-80814852 GCTCCACTGTACTCCAGCCTGGG - Intergenic
957605630 3:82395062-82395084 GCACTACTGTACTCCAGCCTGGG - Intergenic
958123424 3:89324208-89324230 GCATCACTGTACTCCAGCCTGGG - Intronic
958123588 3:89326429-89326451 GCATTACTGCACTCCAGCCTGGG - Intronic
958129524 3:89400234-89400256 GCTCTGCTGTACTCCAGCCTGGG - Intronic
959053823 3:101549982-101550004 GCACTACCGCACTCCAGCCTGGG + Intergenic
959208446 3:103343845-103343867 GCTCTACTGGACTCCAGCCTGGG - Intergenic
959447199 3:106454855-106454877 GCACCACTGTAATCCAGCCTGGG + Intergenic
959473227 3:106778772-106778794 GCATCACTGTACTCCAGCCTGGG - Intergenic
959786974 3:110311016-110311038 GCATGACTGCAATCCAGCCTGGG + Intergenic
959978157 3:112485085-112485107 GCATCACTGTACTCCAGCCTGGG - Intronic
960041659 3:113155917-113155939 GCATTACTGCATTCCAGCCTGGG + Intergenic
960131767 3:114064170-114064192 GCTTCACTGCACTCCAGCCTGGG + Intronic
960814335 3:121657782-121657804 GCACCACCGTACTCCAGCCTGGG + Intronic
961030414 3:123598503-123598525 GCACTACTGTACTCCAGCCTGGG - Intergenic
961198751 3:125026955-125026977 GCGTCACTGTACTCCAGCCTGGG + Intronic
961300907 3:125921446-125921468 GTGCTACGGTAATCCAGCCTGGG - Intergenic
961757540 3:129138236-129138258 GCGTCACTGTACTCCAGCCTGGG + Intronic
961768966 3:129234292-129234314 GCTCTACTGTACTCCAACCTGGG - Intergenic
962289080 3:134115383-134115405 GCACTACTGTACTCCAGCCTGGG + Intronic
962744695 3:138388654-138388676 GCACTACTGTAGTCCAGCCTGGG + Intronic
963163126 3:142173156-142173178 GCGTTACTGCACTCCAGCCTAGG + Intronic
963416579 3:145002586-145002608 GCTTTACAGGAATCATGCCTGGG + Intergenic
963508328 3:146216186-146216208 GCATCACTGTACTCCAGCCTGGG + Intronic
963743556 3:149103198-149103220 ACTCTACTGTACTCCAGCCTGGG + Intergenic
963846324 3:150161472-150161494 GCTCTACTGCACTCCAGCCTGGG - Intergenic
963881753 3:150536354-150536376 GCACCACCGTACTCCAGCCTGGG + Intergenic
963910700 3:150815309-150815331 GCATTACTGCACTCCAGCCTGGG - Intergenic
963946557 3:151152140-151152162 GCTCTACTGCACTCCAGCCTGGG - Intronic
964154299 3:153565473-153565495 GCGTCACTGTACTCCAGCCTGGG - Intergenic
964334884 3:155644558-155644580 GCTTCACTGCACTCCAGCCTAGG + Intronic
964342739 3:155725488-155725510 GCACTATCGTACTCCAGCCTGGG - Intronic
964357055 3:155860629-155860651 GCATCACTGTACTCCAGCCTGGG - Intergenic
964402382 3:156312660-156312682 GCATTACTGCACTCCAGCCTAGG + Intronic
964437444 3:156669422-156669444 TCATTACTGCAATCCAGCCTGGG - Intergenic
964510214 3:157441765-157441787 GCACTACTGCAATCCAGCCTGGG + Intronic
964799528 3:160540040-160540062 CCGTTACTGTACTCCAGCCTGGG - Intronic
964813187 3:160687757-160687779 GCGCCACTGTAATCCAGCCTAGG + Intergenic
964870858 3:161312742-161312764 GCTTCACTGCATTCCAGCCTGGG - Intergenic
965149063 3:164946834-164946856 ACTTTACTGTACTCCAGCCTGGG + Intergenic
965156972 3:165073277-165073299 GCGTCACTGTATTCCAGCCTGGG - Intronic
965284585 3:166801625-166801647 GCGCTACTGTACTCCAGCCTGGG + Intergenic
965765226 3:172123427-172123449 ATTTTACCATATTCCAGCCTGGG - Intronic
965911909 3:173788790-173788812 CCACTACCATAATCCAGCCTGGG + Intronic
966367529 3:179206132-179206154 ACTTGACTGTACTCCAGCCTGGG - Intronic
966419620 3:179724413-179724435 GCTCTACTGCACTCCAGCCTGGG + Intronic
966673245 3:182553387-182553409 GGTTTACTGCACTCCAGCCTGGG - Intergenic
966687412 3:182710963-182710985 GCACCACCGCAATCCAGCCTGGG + Intergenic
966748117 3:183297493-183297515 GCACTACTGTACTCCAGCCTGGG - Intronic
966814785 3:183881162-183881184 GCATCACTGTACTCCAGCCTGGG - Intronic
967059403 3:185858684-185858706 GCATTACTGCATTCCAGCCTGGG - Intergenic
967066234 3:185918929-185918951 GCTCCACTGTACTCCAGCCTAGG + Intronic
967074115 3:185986912-185986934 GCATTACTGTACTCCAGCCTGGG + Intergenic
967091751 3:186140467-186140489 GCTCTACTGCACTCCAGCCTGGG + Intronic
967184979 3:186936897-186936919 GTATTACTGTACTCCAGCCTGGG + Intronic
967283545 3:187846128-187846150 GTGCTACCGTACTCCAGCCTGGG - Intergenic
967436745 3:189456336-189456358 GCTTTACTGAAAACCACCCTTGG + Intergenic
967532624 3:190566464-190566486 CCTTTACTGTAATCCATCCAAGG + Intronic
967560972 3:190919842-190919864 GCTCTACTGCACTCCAGCCTGGG - Intergenic
967731182 3:192908439-192908461 GCGTCACTGTACTCCAGCCTGGG - Intronic
967793226 3:193571234-193571256 GCGTTACTGCACTCCAGCCTGGG + Intronic
967915769 3:194577101-194577123 GCACCACTGTAATCCAGCCTGGG + Intergenic
968029355 3:195469876-195469898 GCATCACTGTACTCCAGCCTGGG - Intergenic
968043977 3:195613184-195613206 GCTCCACTGTACTCCAGCCTGGG - Intergenic
968110233 3:196040133-196040155 GCTCTACTGCACTCCAGCCTGGG - Intronic
968123027 3:196139728-196139750 GCTCTACTGTATTCCAGCCTGGG - Intergenic
968163648 3:196447216-196447238 GCATCACCGCACTCCAGCCTGGG + Intergenic
968309102 3:197667997-197668019 GCTCCACTGTACTCCAGCCTGGG + Intergenic
968557929 4:1258854-1258876 GCATTACTGCACTCCAGCCTGGG - Intergenic
968834993 4:2957042-2957064 ACTCTACCGCACTCCAGCCTGGG - Intronic
969864461 4:10064830-10064852 GCTTTACTGCACTCCAGCCTGGG + Intergenic
969909296 4:10428580-10428602 GCATCACTGTACTCCAGCCTGGG - Intergenic
970279302 4:14436451-14436473 GCTTCACTGCATTCCAGCCTGGG + Intergenic
970562974 4:17300853-17300875 GCACTACTGTACTCCAGCCTAGG + Intergenic
970579399 4:17461037-17461059 GCGCCACCGTACTCCAGCCTGGG - Intronic
971675715 4:29626037-29626059 GCTTCACTGTACTCCAGCCTGGG + Intergenic
971780251 4:31024782-31024804 GCATCACCATACTCCAGCCTAGG - Intronic
971949089 4:33320205-33320227 GCTTCACTGCACTCCAGCCTGGG - Intergenic
972256270 4:37359023-37359045 GCTTTACCGTAATCCAGCCTTGG + Intronic
972449992 4:39187375-39187397 GCGCTACTGTACTCCAGCCTGGG + Intronic
972526275 4:39915400-39915422 GCTCCACTGTACTCCAGCCTGGG - Intronic
972527465 4:39929786-39929808 GCTTCACTGCACTCCAGCCTAGG - Intronic
972548610 4:40106589-40106611 GCGCCACCGTACTCCAGCCTGGG - Intronic
972611985 4:40664298-40664320 GCATTACTGCACTCCAGCCTGGG - Intergenic
972771385 4:42200399-42200421 GCACTACTGTACTCCAGCCTGGG + Intergenic
972794862 4:42405272-42405294 GCGCTACCGCACTCCAGCCTGGG + Intergenic
972925125 4:43995159-43995181 GCGCTACCGCACTCCAGCCTGGG + Intergenic
972942843 4:44218174-44218196 GCGCCACCGTACTCCAGCCTGGG - Intronic
972979354 4:44677495-44677517 GCGCTACTGTACTCCAGCCTGGG + Intronic
973323810 4:48837012-48837034 GCACCACCGTACTCCAGCCTGGG - Intronic
973609233 4:52618528-52618550 GCACTACTGTATTCCAGCCTGGG + Intronic
974037663 4:56831130-56831152 GCACCACCGTACTCCAGCCTGGG + Intergenic
974213902 4:58818968-58818990 GCTGCACCACAATCCAGCCTGGG + Intergenic
974415158 4:61596813-61596835 GCCTTACTGCACTCCAGCCTGGG + Intronic
974426847 4:61752889-61752911 GCTGTACTGCACTCCAGCCTGGG + Intronic
974618508 4:64323352-64323374 GCTTCACTGTACTCCAGTCTGGG + Intronic
975539180 4:75486934-75486956 GCTCCACTGTACTCCAGCCTGGG + Intronic
975610145 4:76195320-76195342 GCTCTACTGCACTCCAGCCTGGG + Intronic
976626652 4:87191417-87191439 GCATCACTGTACTCCAGCCTGGG + Intronic
976723992 4:88197758-88197780 ACATTACCGCACTCCAGCCTGGG + Intronic
976763908 4:88579362-88579384 GCGTCACTGCAATCCAGCCTGGG + Intronic
976951763 4:90841533-90841555 GCTCCACTGTATTCCAGCCTGGG + Intronic
977236710 4:94516564-94516586 GCACTACCATACTCCAGCCTGGG - Intronic
977489035 4:97688407-97688429 GCGCTACTGTACTCCAGCCTGGG - Intronic
977614221 4:99069514-99069536 GCACTACCGCACTCCAGCCTGGG - Intergenic
978247115 4:106586617-106586639 GCCCTACTGTACTCCAGCCTGGG + Intergenic
979385400 4:120058584-120058606 GCGTCACTGTACTCCAGCCTGGG + Exonic
979670770 4:123358003-123358025 GCATTACTGCACTCCAGCCTGGG - Intergenic
979766327 4:124468686-124468708 CCTTTACTGTACTCTAGCCTGGG - Intergenic
980004367 4:127524546-127524568 GCATCACTGTACTCCAGCCTAGG - Intergenic
980134384 4:128845879-128845901 GTGTTACCGCACTCCAGCCTGGG + Intronic
980459618 4:133090791-133090813 GCATCACTGCAATCCAGCCTAGG + Intergenic
981744615 4:148040382-148040404 GCATGACTGTACTCCAGCCTGGG - Intronic
981776433 4:148373515-148373537 GCGCTACTGTACTCCAGCCTGGG - Intronic
981783287 4:148449571-148449593 GCACCACCGTACTCCAGCCTGGG + Intergenic
982185182 4:152789131-152789153 GCGTTACTGCACTCCAGCCTGGG - Intronic
982535623 4:156603628-156603650 GCTTTGCAGTAGTACAGCCTAGG - Intergenic
982575116 4:157099377-157099399 GTTTCACTGTACTCCAGCCTGGG - Intronic
982585407 4:157230894-157230916 GCTCTACTGCACTCCAGCCTGGG - Intronic
982946860 4:161635343-161635365 GCATCACTGTACTCCAGCCTGGG + Intronic
983224095 4:165070023-165070045 GCGCCACCGTACTCCAGCCTGGG + Intergenic
983558049 4:169076078-169076100 GCAGTACTGTACTCCAGCCTGGG - Intergenic
984038415 4:174698232-174698254 GCTTCACTGCACTCCAGCCTGGG - Intronic
984117721 4:175703212-175703234 GCACTACTGTAGTCCAGCCTGGG - Intronic
984262701 4:177461274-177461296 GCTTCACTGCAATCCAGCCTGGG - Intergenic
984683334 4:182636672-182636694 GCGCCACCGTACTCCAGCCTGGG + Intronic
984773583 4:183460487-183460509 GCTCCACTGTACTCCAGCCTGGG + Intergenic
985260479 4:188110438-188110460 GCTCCACCGCACTCCAGCCTAGG - Intergenic
985435893 4:189929200-189929222 GCTTTACAGCAGTACAGCCTAGG - Intergenic
986473824 5:8103986-8104008 GCACCACTGTAATCCAGCCTGGG - Intergenic
986927250 5:12769911-12769933 GCGTCACCGCACTCCAGCCTGGG + Intergenic
986967651 5:13294682-13294704 GTGTCACTGTAATCCAGCCTGGG - Intergenic
987296923 5:16561452-16561474 GCTCTACCACACTCCAGCCTGGG + Intronic
987310670 5:16678535-16678557 GCACTACCGCACTCCAGCCTGGG + Intronic
987347787 5:16993976-16993998 GCATGACTGTACTCCAGCCTGGG + Intergenic
987425239 5:17765791-17765813 GCATCACTGTACTCCAGCCTGGG - Intergenic
988329328 5:29814951-29814973 GCTCTACTGCACTCCAGCCTGGG + Intergenic
988465727 5:31489919-31489941 GCGTCACCGCACTCCAGCCTGGG - Intronic
990153716 5:52850043-52850065 GCTCCACTGTACTCCAGCCTGGG - Intronic
990311252 5:54541068-54541090 GCGCCACCGTACTCCAGCCTGGG - Intronic
991142158 5:63257457-63257479 GCTCCACTGTATTCCAGCCTGGG - Intergenic
991713641 5:69431877-69431899 GCATTACTGCACTCCAGCCTGGG - Intronic
992069104 5:73133645-73133667 GCATCACTGTATTCCAGCCTGGG - Intergenic
992119819 5:73581094-73581116 GCATCACTGTACTCCAGCCTGGG - Exonic
992315307 5:75546706-75546728 GCGCTACCGCACTCCAGCCTGGG - Intronic
992462016 5:76969988-76970010 ACATTACTGTACTCCAGCCTAGG - Intronic
992511781 5:77443923-77443945 GTGTTACTGTACTCCAGCCTGGG - Intronic
992595988 5:78347758-78347780 GCTCCACTGTACTCCAGCCTTGG - Intergenic
992683632 5:79178213-79178235 GCACTACTGTACTCCAGCCTGGG + Intronic
992728126 5:79630090-79630112 GCGTCACTGTACTCCAGCCTGGG + Intronic
992777134 5:80098264-80098286 GCACCACCGTACTCCAGCCTGGG + Intergenic
992853496 5:80835870-80835892 GCACCACCGTACTCCAGCCTGGG + Intronic
993036100 5:82759411-82759433 GCTCCACCGTACTCCAGCCTGGG - Intergenic
993343304 5:86752104-86752126 GCATCACTGTACTCCAGCCTGGG - Intergenic
994677254 5:102839492-102839514 TCTTCACTGTACTCCAGCCTGGG + Intronic
995147189 5:108799883-108799905 GCACCACCGTACTCCAGCCTGGG - Intronic
995149073 5:108821067-108821089 GCTCCACTGTACTCCAGCCTGGG + Intronic
995499352 5:112786928-112786950 GCATGACTGTACTCCAGCCTAGG - Intronic
995517228 5:112966421-112966443 GCATCACCGCACTCCAGCCTGGG - Intergenic
995618245 5:113991656-113991678 GCATCACCGCACTCCAGCCTGGG + Intergenic
996156814 5:120112705-120112727 GCATTACTGCACTCCAGCCTGGG - Intergenic
996212004 5:120822388-120822410 GCATTACTGCATTCCAGCCTGGG - Intergenic
996570269 5:124926490-124926512 GCACTACCGCACTCCAGCCTGGG - Intergenic
996730335 5:126711559-126711581 GCCTTACTGTACTCCAGCCTGGG - Intergenic
996873860 5:128220028-128220050 GCACTACCGCACTCCAGCCTGGG - Intergenic
997093945 5:130889696-130889718 GCTCCACCGCACTCCAGCCTGGG - Intergenic
997135602 5:131321891-131321913 GCGTCACCGCACTCCAGCCTGGG - Intronic
997244191 5:132332269-132332291 GCACTACTGTACTCCAGCCTGGG + Intronic
997334638 5:133098352-133098374 GCGTCACCGCACTCCAGCCTGGG - Intronic
997879595 5:137577866-137577888 GCACTACCGCACTCCAGCCTGGG - Intronic
998017146 5:138741280-138741302 GCATTACTGCACTCCAGCCTGGG + Intronic
998057933 5:139095304-139095326 GCACCACCGTACTCCAGCCTGGG - Intronic
998118721 5:139559381-139559403 GCGTCACCGCACTCCAGCCTGGG + Intronic
998221625 5:140286646-140286668 GCATCACTGTACTCCAGCCTGGG - Intronic
998420774 5:141984138-141984160 GCACTACCGCACTCCAGCCTGGG - Intronic
998469265 5:142370595-142370617 GCTTTAGAGTCACCCAGCCTGGG + Intergenic
998516028 5:142755157-142755179 GCATTACTGCACTCCAGCCTGGG - Intergenic
998547091 5:143038736-143038758 GCATTACTGCACTCCAGCCTGGG - Intronic
999305477 5:150516706-150516728 ACATCACCGTACTCCAGCCTGGG - Intronic
999332551 5:150686185-150686207 GCGTTACTGCACTCCAGCCTTGG - Intergenic
999483096 5:151966931-151966953 GCACTACTGTACTCCAGCCTTGG - Intergenic
999582723 5:153057638-153057660 GCTTTACAGGAACCAAGCCTAGG + Intergenic
1000080520 5:157841221-157841243 GTGTCACTGTAATCCAGCCTGGG + Intronic
1000103708 5:158038722-158038744 ACTTTACTGCACTCCAGCCTGGG + Intergenic
1000426950 5:161102314-161102336 GCTCCACCGCACTCCAGCCTGGG - Intergenic
1000777463 5:165438930-165438952 GCGTTACTGCACTCCAGCCTGGG - Intergenic
1000860550 5:166451269-166451291 GCACCACCGTACTCCAGCCTGGG - Intergenic
1000861828 5:166465127-166465149 GCGTCACCGTACTCCAGCCTAGG - Intergenic
1000946573 5:167429647-167429669 GCTTCACTGCACTCCAGCCTGGG - Intronic
1001039868 5:168326579-168326601 GCATCACTGTACTCCAGCCTGGG - Intronic
1001054876 5:168441027-168441049 GCATCACCGCACTCCAGCCTGGG + Intronic
1001573330 5:172745100-172745122 GCGTTACTGCACTCCAGCCTGGG - Intergenic
1001593127 5:172880074-172880096 GCTCTGCAGTACTCCAGCCTGGG - Intronic
1001969770 5:175946033-175946055 GCGCTACCGCACTCCAGCCTGGG - Intronic
1002113650 5:176939212-176939234 GTATCACTGTAATCCAGCCTGGG + Intronic
1002247665 5:177897735-177897757 GCACTACCGCACTCCAGCCTGGG + Intergenic
1002278425 5:178117566-178117588 GCACTACTGTAGTCCAGCCTGGG + Intronic
1002291261 5:178202589-178202611 GCTCCACTGTACTCCAGCCTGGG + Intergenic
1002349501 5:178573899-178573921 GCATCACTGTACTCCAGCCTGGG - Intronic
1002609892 5:180409772-180409794 GCATCACTGTACTCCAGCCTGGG + Intergenic
1002719660 5:181250491-181250513 GCGTCACCGCACTCCAGCCTGGG + Intergenic
1003182413 6:3803428-3803450 GCATCACCGCACTCCAGCCTGGG - Intergenic
1003258071 6:4491111-4491133 GCACCACCGTACTCCAGCCTGGG + Intergenic
1003359335 6:5409406-5409428 GCACCACCGTACTCCAGCCTGGG + Intronic
1003923620 6:10856265-10856287 GCATTACAGCACTCCAGCCTGGG + Intronic
1004145677 6:13063735-13063757 GCACTACTGTACTCCAGCCTGGG + Intronic
1004466736 6:15892326-15892348 GCCTCACTGTACTCCAGCCTGGG + Intergenic
1004649883 6:17598934-17598956 GCGTCACCGCACTCCAGCCTGGG - Intergenic
1004682675 6:17911805-17911827 GCATTACTGTACTCCAGCTTGGG - Intronic
1004695352 6:18028026-18028048 GCGTTACTGCACTCCAGCCTGGG - Intergenic
1004724988 6:18302750-18302772 GCTCCACCGCACTCCAGCCTGGG - Intergenic
1004922078 6:20385287-20385309 GCGCTACTGTACTCCAGCCTGGG - Intergenic
1005033555 6:21534573-21534595 GCGCTACTGTACTCCAGCCTGGG + Intergenic
1005075627 6:21903752-21903774 GCGCTACTGTACTCCAGCCTGGG - Intergenic
1005304433 6:24499532-24499554 GCATCACTGTACTCCAGCCTAGG - Intronic
1005334357 6:24778457-24778479 GCTTCACTGCACTCCAGCCTGGG + Intronic
1005586063 6:27277704-27277726 GCTCCACTGTACTCCAGCCTGGG - Intergenic
1006124866 6:31831032-31831054 GCTCTACTGTGCTCCAGCCTGGG - Intergenic
1006125016 6:31832166-31832188 GCTCCACTGTACTCCAGCCTGGG - Intergenic
1006344577 6:33470461-33470483 GCATCACTGTACTCCAGCCTAGG - Intergenic
1006420289 6:33929329-33929351 GCGCCACCGTACTCCAGCCTGGG + Intergenic
1006885624 6:37379954-37379976 GCGTTACTGCACTCCAGCCTGGG - Intronic
1006890810 6:37426574-37426596 GCGTTACTGCACTCCAGCCTGGG - Intergenic
1006954438 6:37855185-37855207 GCACTACTGTACTCCAGCCTGGG - Intronic
1007021191 6:38523138-38523160 GCTCCACTGTACTCCAGCCTGGG + Intronic
1007100687 6:39244303-39244325 GTGTTACTGTACTCCAGCCTGGG - Intergenic
1007490304 6:42216064-42216086 GCTCCACTGTACTCCAGCCTGGG - Intronic
1007493264 6:42240933-42240955 GCGCCACCGTACTCCAGCCTGGG - Intronic
1007669811 6:43542450-43542472 ATGTTACCGTACTCCAGCCTGGG - Intronic
1007679290 6:43623345-43623367 GCTCCACTGCAATCCAGCCTGGG + Intronic
1007771580 6:44196618-44196640 GCGTTACTGTACTCCAGCCTGGG + Intergenic
1007849659 6:44791153-44791175 GCATCACTGTAATCCAGCCTGGG + Intergenic
1007887745 6:45250867-45250889 GCACTACTGTATTCCAGCCTGGG - Intronic
1009989856 6:70828829-70828851 GCTCCACTGTACTCCAGCCTGGG + Intronic
1010100930 6:72107516-72107538 GCATCACTGTACTCCAGCCTGGG + Intronic
1010160867 6:72853384-72853406 GCACCACCGCAATCCAGCCTGGG - Intronic
1010284158 6:74055584-74055606 GCGCTACCGCACTCCAGCCTGGG + Intergenic
1010345311 6:74803678-74803700 GCATCACTGCAATCCAGCCTGGG - Intergenic
1010380108 6:75214491-75214513 GCAGTACGGTACTCCAGCCTGGG - Intergenic
1010449813 6:75989798-75989820 GCTCCACTGTACTCCAGCCTGGG + Intronic
1010560754 6:77346979-77347001 ACATTACTGTACTCCAGCCTGGG - Intergenic
1010797413 6:80133683-80133705 GCATTACTGCACTCCAGCCTGGG - Intronic
1011307026 6:85938817-85938839 GCACCACTGTAATCCAGCCTGGG - Intergenic
1012591257 6:100984392-100984414 GCTCCACTGTACTCCAGCCTGGG - Intergenic
1012768584 6:103400167-103400189 GCACTACTGTATTCCAGCCTGGG - Intergenic
1012861016 6:104559553-104559575 GCACTACTGTACTCCAGCCTAGG - Intergenic
1013096609 6:106951340-106951362 GCCTTACTGCACTCCAGCCTGGG - Intergenic
1013128412 6:107208027-107208049 GCGCCACCGTACTCCAGCCTGGG - Intronic
1013474368 6:110493889-110493911 GCACCACCGTACTCCAGCCTGGG + Intergenic
1013487175 6:110608166-110608188 GCACTACTGTACTCCAGCCTGGG - Intergenic
1013524902 6:110964873-110964895 GCACTACTGTACTCCAGCCTGGG - Intronic
1013547346 6:111171092-111171114 GCGTCACCGCACTCCAGCCTGGG + Intronic
1013557138 6:111267778-111267800 GCCACACCGTACTCCAGCCTGGG + Exonic
1014412155 6:121138885-121138907 GCTCTACTGCACTCCAGCCTGGG - Intronic
1014435017 6:121411000-121411022 GCTCCACTGTACTCCAGCCTGGG + Intergenic
1014489645 6:122046010-122046032 GCACTACTGTACTCCAGCCTGGG + Intergenic
1014526580 6:122508791-122508813 GCGTTACTGCATTCCAGCCTGGG - Intronic
1014930561 6:127331188-127331210 GCTTCACTGTACTCCAGCCTGGG - Intronic
1014985083 6:127996512-127996534 GCATTACTGCACTCCAGCCTGGG - Intronic
1015003870 6:128255031-128255053 GCGTCACTGTACTCCAGCCTGGG - Intronic
1015179181 6:130343920-130343942 GCACCACTGTAATCCAGCCTGGG + Intronic
1015293030 6:131559932-131559954 GCGTCACTGTATTCCAGCCTGGG - Intergenic
1015446451 6:133311366-133311388 GCATCACTGCAATCCAGCCTGGG - Intronic
1015457132 6:133439005-133439027 GCACTACTGTACTCCAGCCTGGG + Intronic
1015491353 6:133829837-133829859 GCTCCACTGTACTCCAGCCTGGG - Intergenic
1015524573 6:134163440-134163462 GCATCACTGTACTCCAGCCTGGG + Intergenic
1015528536 6:134197188-134197210 GCACTACCGCACTCCAGCCTGGG + Intronic
1015586758 6:134784223-134784245 GCATTACTGCACTCCAGCCTGGG + Intergenic
1015903693 6:138094762-138094784 GCATTGCTGTACTCCAGCCTGGG - Intronic
1015946878 6:138511863-138511885 GCTCCACCGCACTCCAGCCTGGG + Intronic
1015998819 6:139021991-139022013 GCGTTACTGCACTCCAGCCTGGG + Intergenic
1016064137 6:139661778-139661800 GCGCCACTGTAATCCAGCCTAGG - Intergenic
1016834683 6:148465498-148465520 GCATCACTGTACTCCAGCCTGGG + Intronic
1016875022 6:148856057-148856079 GCGTTACTGCACTCCAGCCTGGG - Intronic
1016954770 6:149615753-149615775 TATTTACTGTACTCCAGCCTGGG + Intronic
1016978858 6:149835563-149835585 GCGTCACTGTACTCCAGCCTGGG + Intronic
1017138079 6:151165592-151165614 GCGTCACTGCAATCCAGCCTGGG + Intergenic
1017426291 6:154324763-154324785 GCGCTACTGTACTCCAGCCTGGG + Intronic
1017655978 6:156630432-156630454 GCTCCACTGTACTCCAGCCTGGG + Intergenic
1017731296 6:157318887-157318909 GCTTTCCGGTAATGCAGCCGTGG + Exonic
1018307236 6:162470546-162470568 GCATTACTGCACTCCAGCCTAGG + Intronic
1018553136 6:165021519-165021541 CCTTCACCATAATCCAGTCTTGG - Intergenic
1018993130 6:168689783-168689805 GCTTCACTGCACTCCAGCCTGGG - Intergenic
1019003932 6:168780486-168780508 ACTTTCCTGTGATCCAGCCTGGG - Intergenic
1019077601 6:169401195-169401217 GCTCCACTGTACTCCAGCCTGGG - Intergenic
1019794049 7:3036726-3036748 GCACTACTGTACTCCAGCCTGGG - Intronic
1019987118 7:4665284-4665306 GCTCCACTGTACTCCAGCCTAGG + Intergenic
1020024081 7:4886332-4886354 GCCTCACCGCACTCCAGCCTGGG - Intergenic
1020024878 7:4892543-4892565 GCATTACTGTACTCCAGCCTGGG + Intergenic
1020132203 7:5565100-5565122 GCATTACTGCACTCCAGCCTGGG + Intergenic
1020197414 7:6052127-6052149 GCACTACCGCACTCCAGCCTGGG + Intronic
1020203004 7:6094828-6094850 GCGTCACTGTACTCCAGCCTGGG - Intergenic
1020327107 7:6983410-6983432 GCATCACTGTACTCCAGCCTGGG - Intergenic
1020388791 7:7636093-7636115 GCACAACCGTATTCCAGCCTGGG + Intergenic
1020780386 7:12510216-12510238 GCTGGATCGTGATCCAGCCTGGG - Intergenic
1020995315 7:15256383-15256405 GCGCCACCGTACTCCAGCCTGGG - Intronic
1021535623 7:21701330-21701352 ACATTACTGTACTCCAGCCTGGG - Intronic
1021674990 7:23071278-23071300 GCATTACTGCACTCCAGCCTGGG + Intergenic
1021887954 7:25158324-25158346 GCACTACTGTACTCCAGCCTGGG + Intronic
1021993353 7:26157067-26157089 GCTCTACTGCACTCCAGCCTGGG + Intronic
1022070967 7:26913917-26913939 GCGCTACCGCAGTCCAGCCTGGG + Intronic
1022236620 7:28467705-28467727 GCTTTTCTGTTATCCATCCTAGG - Intronic
1023029062 7:36077358-36077380 GCTCTACTGCACTCCAGCCTGGG + Intergenic
1023346907 7:39279787-39279809 GCTCTACTGTATTCCAGCCCAGG - Intronic
1024145838 7:46515484-46515506 GGTTTAACATCATCCAGCCTTGG + Intergenic
1024373022 7:48607921-48607943 GCATTGCTGTACTCCAGCCTGGG - Intronic
1024633406 7:51267615-51267637 GCGCTACTGTACTCCAGCCTGGG - Intronic
1024735508 7:52300438-52300460 GCTTCACTGCACTCCAGCCTGGG + Intergenic
1025089312 7:56049479-56049501 GCATTACTGCACTCCAGCCTGGG - Intronic
1025763228 7:64414598-64414620 GCACTACTGTACTCCAGCCTGGG + Intergenic
1025773828 7:64540345-64540367 GCACTACTGTACTCCAGCCTGGG - Intronic
1025816389 7:64916151-64916173 GCATCACTGTACTCCAGCCTGGG + Intronic
1025865655 7:65378249-65378271 GCGTTACTGCACTCCAGCCTGGG + Intronic
1025944231 7:66093827-66093849 GCATTACTGCACTCCAGCCTGGG + Intronic
1025956718 7:66188616-66188638 GCACTACCGCACTCCAGCCTGGG + Intergenic
1026034324 7:66820223-66820245 GCATTACTGCACTCCAGCCTGGG - Intergenic
1026095408 7:67342546-67342568 GCTTCACTGCAGTCCAGCCTGGG + Intergenic
1026140323 7:67700116-67700138 GCACTACTGTACTCCAGCCTGGG - Intergenic
1026175498 7:67993166-67993188 GCTCCACTGTACTCCAGCCTGGG - Intergenic
1026364703 7:69636271-69636293 GCTCTACTGCACTCCAGCCTGGG - Intronic
1026420071 7:70226228-70226250 GCTCTACTGTACTCCAGACTGGG - Intronic
1026449856 7:70518744-70518766 GCATCACTGTACTCCAGCCTGGG - Intronic
1026511257 7:71029063-71029085 GCACCACCGTACTCCAGCCTGGG + Intergenic
1026625623 7:71989394-71989416 GCATCACTGTACTCCAGCCTGGG + Intronic
1026638520 7:72104912-72104934 GCATCACTGTACTCCAGCCTGGG + Intronic
1026712996 7:72759290-72759312 GCACCACCGTAATCCAGCCTGGG + Intronic
1026775924 7:73231086-73231108 GCATTACTGCACTCCAGCCTGGG - Intergenic
1027016781 7:74784457-74784479 GCATTACTGCACTCCAGCCTGGG - Intronic
1027071246 7:75161479-75161501 GCATTACTGCACTCCAGCCTGGG + Intergenic
1027135752 7:75622798-75622820 GCGTTACTGCACTCCAGCCTGGG + Intronic
1027390735 7:77701107-77701129 GCGTCACTGTACTCCAGCCTGGG + Intronic
1027401158 7:77809267-77809289 GCTCCACTGTACTCCAGCCTGGG - Intronic
1027631139 7:80607812-80607834 GCACCACCGTACTCCAGCCTGGG - Intronic
1027957066 7:84893706-84893728 TCACCACCGTAATCCAGCCTGGG + Intergenic
1028191675 7:87860152-87860174 GCATTACTGCACTCCAGCCTAGG + Intronic
1028293079 7:89092453-89092475 GCACTACTGTACTCCAGCCTGGG - Intronic
1028415703 7:90578281-90578303 GCTTCACTGCACTCCAGCCTGGG + Intronic
1028557166 7:92136447-92136469 GCGTCACTGTACTCCAGCCTGGG + Intronic
1029000428 7:97148492-97148514 GCCCTACTGTACTCCAGCCTGGG + Intronic
1029106734 7:98183428-98183450 GCACTACTGCAATCCAGCCTGGG - Intronic
1029193554 7:98788509-98788531 GCATCACCGTACTCTAGCCTGGG + Intergenic
1029358973 7:100074311-100074333 GCATTACTGCAGTCCAGCCTGGG - Intronic
1029469427 7:100744924-100744946 GCGTCACCGCACTCCAGCCTGGG - Intronic
1029529343 7:101114952-101114974 GCGCCACCGTACTCCAGCCTAGG - Intergenic
1029555435 7:101265642-101265664 GCAACACCGTACTCCAGCCTGGG - Intergenic
1029594581 7:101530520-101530542 GCATCACTGTACTCCAGCCTGGG + Intronic
1029604795 7:101592003-101592025 GCACTACTGTATTCCAGCCTGGG + Intergenic
1029731703 7:102442642-102442664 GCTCTACTGCACTCCAGCCTCGG + Intronic
1029834986 7:103299811-103299833 GCGTCACCGCACTCCAGCCTAGG - Intronic
1029897128 7:103994818-103994840 GCATCACTGTATTCCAGCCTGGG + Intergenic
1029909887 7:104134370-104134392 GCACTACTGTACTCCAGCCTGGG + Intronic
1030011511 7:105173154-105173176 GCTCTACTGCACTCCAGCCTGGG - Intronic
1031085838 7:117300754-117300776 GCATCACTGTACTCCAGCCTGGG + Intronic
1031404461 7:121367921-121367943 GCGTCACTGTACTCCAGCCTGGG + Intronic
1031771689 7:125851815-125851837 GCACTACTGTACTCCAGCCTGGG + Intergenic
1031820254 7:126492097-126492119 GCACCACCGTACTCCAGCCTAGG - Intronic
1032001674 7:128269753-128269775 GCTCCACTGTACTCCAGCCTAGG + Intergenic
1032216039 7:129958078-129958100 GCATTACTGCATTCCAGCCTGGG - Intergenic
1032240622 7:130156027-130156049 GCTCTACTGCAGTCCAGCCTGGG + Intergenic
1032261407 7:130340381-130340403 GCACTACTGTACTCCAGCCTGGG - Intergenic
1032357930 7:131227606-131227628 GCTCCACCGCACTCCAGCCTGGG - Intronic
1032438590 7:131923128-131923150 GCGTCATCGTACTCCAGCCTGGG - Intergenic
1032843775 7:135735743-135735765 GCACCACCGTACTCCAGCCTGGG - Intronic
1032918333 7:136516739-136516761 GCACTACTGTACTCCAGCCTGGG + Intergenic
1033091606 7:138391253-138391275 GTACTACCGTACTCCAGCCTGGG - Intergenic
1033205776 7:139420839-139420861 GCATTACTGCACTCCAGCCTGGG - Intronic
1033736251 7:144224911-144224933 GCATCACTGTACTCCAGCCTGGG + Intergenic
1033746803 7:144326044-144326066 GCGTCACTGTACTCCAGCCTGGG - Intergenic
1033988509 7:147255777-147255799 GCACTACTGTACTCCAGCCTGGG - Intronic
1034030609 7:147758800-147758822 GCTCCACTGTACTCCAGCCTGGG + Intronic
1034088833 7:148345403-148345425 GCGTCACTGTACTCCAGCCTGGG - Intronic
1034288070 7:149903961-149903983 GCGTCACCGCACTCCAGCCTGGG - Intergenic
1034506931 7:151499849-151499871 GCTCTACTGCACTCCAGCCTGGG - Intronic
1034515601 7:151576022-151576044 GCTGCACTGTACTCCAGCCTGGG - Intronic
1034516509 7:151584852-151584874 GCACTACCATACTCCAGCCTGGG + Intronic
1034577959 7:152017886-152017908 GCATCACCGCACTCCAGCCTGGG - Intronic
1034663057 7:152788977-152788999 GCGTCACCGCACTCCAGCCTGGG + Intronic
1035166740 7:156994951-156994973 GCATCACTGTACTCCAGCCTGGG + Intronic
1035767267 8:2116798-2116820 GCATCACCGCACTCCAGCCTGGG - Intronic
1035934283 8:3819624-3819646 GCTCCACTGTACTCCAGCCTGGG - Intronic
1035945982 8:3962977-3962999 GCTCCACCGCACTCCAGCCTGGG - Intronic
1036194896 8:6705834-6705856 GCGTCACTGCAATCCAGCCTGGG - Intergenic
1036657604 8:10687571-10687593 GCTCCACTGCAATCCAGCCTGGG + Intronic
1036730201 8:11256191-11256213 GCTTTTCTGGCATCCAGCCTGGG - Intergenic
1036740208 8:11354437-11354459 GCGCTACTGTACTCCAGCCTGGG + Intergenic
1037261019 8:17008294-17008316 GCACTACCGCACTCCAGCCTGGG + Intergenic
1037393499 8:18418745-18418767 GCTCCACTGTACTCCAGCCTGGG + Intergenic
1037447803 8:18984974-18984996 ACGCTACCGTACTCCAGCCTGGG - Intronic
1037704866 8:21310372-21310394 GATACACCGTAATCCAGTCTGGG + Intergenic
1037834019 8:22205730-22205752 GCACTACTGTACTCCAGCCTGGG + Intronic
1037846488 8:22287202-22287224 GCTTCACTGCACTCCAGCCTGGG + Intronic
1037937152 8:22922681-22922703 GCATCACCGCACTCCAGCCTGGG + Intronic
1038124974 8:24663592-24663614 GCGTTACTGCACTCCAGCCTGGG - Intergenic
1038130005 8:24719391-24719413 GCGCTACCGCACTCCAGCCTGGG + Intergenic
1038151144 8:24942902-24942924 GCGTTACTGCACTCCAGCCTGGG - Intergenic
1038247722 8:25874726-25874748 GCACTACTGTACTCCAGCCTGGG - Intronic
1038312213 8:26453369-26453391 GCATCACTGTACTCCAGCCTGGG - Intronic
1038533083 8:28334535-28334557 GCTGTACTGCACTCCAGCCTTGG - Intronic
1038566951 8:28627452-28627474 GCATCACTGTATTCCAGCCTGGG + Intronic
1038605148 8:28994122-28994144 GCGCTACTGCAATCCAGCCTGGG + Intronic
1038948018 8:32383180-32383202 GCATTACTGCATTCCAGCCTTGG + Intronic
1038954283 8:32450457-32450479 GCGTGACTGTACTCCAGCCTGGG - Intronic
1039355042 8:36805884-36805906 GCTTCACTGTACTGCAGCCTAGG - Intronic
1039583742 8:38687882-38687904 GCATCACTGTACTCCAGCCTGGG + Intergenic
1039830673 8:41211369-41211391 GCTTCACTGTACTCCAGCCTGGG - Intergenic
1039889592 8:41675131-41675153 GCATTACTGCACTCCAGCCTGGG - Intronic
1039915605 8:41858303-41858325 GCATCACCGCAATCCAGCCTGGG + Intronic
1039969590 8:42309688-42309710 GCATCACTGCAATCCAGCCTGGG + Intronic
1040024905 8:42772672-42772694 GCATCACTGTACTCCAGCCTGGG + Intronic
1040057000 8:43067760-43067782 ACGTCACCGTACTCCAGCCTGGG - Intronic
1040068184 8:43165891-43165913 GCTCCACTGTACTCCAGCCTAGG + Intronic
1040432252 8:47354996-47355018 GCTTCACTGCACTCCAGCCTGGG - Intronic
1040506845 8:48056764-48056786 GCACCACCGCAATCCAGCCTGGG - Intronic
1040663893 8:49607237-49607259 GCATCACCGCACTCCAGCCTGGG + Intergenic
1040740569 8:50570299-50570321 GCACCACTGTAATCCAGCCTGGG - Intronic
1041084849 8:54247302-54247324 ACTTCACTGCAATCCAGCCTGGG + Intergenic
1041239830 8:55839916-55839938 GCTCCACCGCACTCCAGCCTGGG + Intergenic
1041454045 8:58038707-58038729 GCATCACTGTACTCCAGCCTGGG + Intronic
1041685173 8:60637217-60637239 GCTTCACTGCACTCCAGCCTGGG + Intergenic
1041744829 8:61197560-61197582 GCACTACTGTACTCCAGCCTGGG - Intronic
1041915109 8:63131298-63131320 GCATTACTGAAATCCAGCCTGGG - Intergenic
1041915563 8:63135511-63135533 GCGCTACCGCACTCCAGCCTGGG - Intergenic
1042140199 8:65670745-65670767 GCTCCACTGTACTCCAGCCTGGG - Intronic
1042142332 8:65691690-65691712 GCGCTACTGCAATCCAGCCTGGG - Intronic
1042820830 8:72928233-72928255 GCGTCACCATACTCCAGCCTGGG - Intronic
1042876350 8:73443803-73443825 GCTCCACTGTACTCCAGCCTAGG + Intronic
1043930966 8:86091290-86091312 GCACCACTGTAATCCAGCCTGGG + Intronic
1043973303 8:86557190-86557212 GCAGTACTGTACTCCAGCCTGGG - Intronic
1044035513 8:87298525-87298547 GCTCCACTGTACTCCAGCCTGGG - Intronic
1044116122 8:88335960-88335982 GCATCACTGTACTCCAGCCTGGG + Intergenic
1044417273 8:91951306-91951328 GCTTTACAGCAGTACAGCCTTGG - Intergenic
1044563712 8:93640116-93640138 GCTCCACTGTACTCCAGCCTGGG - Intergenic
1044684966 8:94817970-94817992 GCATCACTGTACTCCAGCCTGGG - Intronic
1044827307 8:96210639-96210661 GCGTCACCGTACTCCAGCCTGGG + Intergenic
1044862240 8:96534475-96534497 GCATCACTGTACTCCAGCCTAGG - Intronic
1045028396 8:98111561-98111583 ACGTTACTGTACTCCAGCCTGGG + Intronic
1045229580 8:100290155-100290177 GCTTCACTGCACTCCAGCCTGGG - Intronic
1045256090 8:100523684-100523706 GCATCACTGTATTCCAGCCTGGG - Intronic
1045267825 8:100635280-100635302 GCACCACCGTACTCCAGCCTGGG - Intronic
1045551007 8:103172437-103172459 ACTGTACTGTACTCCAGCCTGGG - Intronic
1046004832 8:108466493-108466515 GCCTCACTGCAATCCAGCCTGGG - Intronic
1046177573 8:110598433-110598455 GTGTCACCGTACTCCAGCCTGGG + Intergenic
1046188862 8:110762890-110762912 GCTCTATTGTACTCCAGCCTGGG + Intergenic
1046502101 8:115091806-115091828 GCATCACTGTACTCCAGCCTGGG - Intergenic
1046870028 8:119195965-119195987 GCACTACTGTACTCCAGCCTGGG + Intronic
1046870093 8:119196717-119196739 GCACTACTGTACTCCAGCCTGGG - Intronic
1046922191 8:119743024-119743046 GCACTACCGCACTCCAGCCTGGG + Intronic
1046923696 8:119763809-119763831 GCACCACCGTACTCCAGCCTGGG + Intronic
1046944126 8:119958737-119958759 ACGTCACCGTACTCCAGCCTGGG + Intronic
1046997690 8:120542609-120542631 GCTCCACTGTACTCCAGCCTGGG + Intronic
1047047459 8:121070838-121070860 GCATCACTGTACTCCAGCCTGGG - Intergenic
1047063027 8:121249294-121249316 GCACTACTGTACTCCAGCCTGGG - Intergenic
1047196079 8:122722519-122722541 GCATCACCGTACTCCAACCTGGG + Intergenic
1047219300 8:122906711-122906733 GCCCTACTGTACTCCAGCCTGGG - Intronic
1047243848 8:123120627-123120649 GCTCTACAGCACTCCAGCCTGGG + Intronic
1047279231 8:123430736-123430758 GCTTCACTGTACTCCAGCTTGGG + Intronic
1047363654 8:124192778-124192800 GCATCACCGCATTCCAGCCTGGG - Intergenic
1047365166 8:124204788-124204810 GCATCACTGTACTCCAGCCTGGG - Intergenic
1047420169 8:124701192-124701214 GCACTACTGTACTCCAGCCTAGG + Intronic
1047441932 8:124886279-124886301 GCTCCACCGCACTCCAGCCTAGG + Intergenic
1047621126 8:126608913-126608935 GCATCACTGTACTCCAGCCTGGG + Intergenic
1047874811 8:129124121-129124143 GCTCTACTGCACTCCAGCCTGGG - Intergenic
1048444728 8:134484836-134484858 GCATCACTGTACTCCAGCCTGGG - Intronic
1049055267 8:140231533-140231555 GCACCACTGTAATCCAGCCTGGG - Intronic
1049091288 8:140516188-140516210 GCGCCACCGCAATCCAGCCTGGG - Exonic
1049456509 8:142694023-142694045 GCTTTGCTGTACTGCAGCCTTGG - Intergenic
1049751021 8:144284072-144284094 GCACCACCGTACTCCAGCCTGGG + Intronic
1049833687 8:144719005-144719027 GCTTCACTGCACTCCAGCCTGGG + Intergenic
1049947331 9:609585-609607 GCTCCACTGTACTCCAGCCTGGG + Intronic
1050157256 9:2680510-2680532 GCTCCACTGTACTCCAGCCTGGG - Intergenic
1050318631 9:4428439-4428461 ACTGTACTGTACTCCAGCCTGGG + Intergenic
1050366442 9:4877843-4877865 GCATCACCGCACTCCAGCCTGGG - Intronic
1050541164 9:6671611-6671633 GCATTGCTGTACTCCAGCCTGGG - Intergenic
1051393231 9:16589549-16589571 GCACCACCGTACTCCAGCCTGGG - Intronic
1051499173 9:17758517-17758539 GCTCTACTGCACTCCAGCCTGGG + Intronic
1052156439 9:25197857-25197879 GCACTACTGTACTCCAGCCTGGG - Intergenic
1052737485 9:32357784-32357806 GCATGACCGCACTCCAGCCTAGG - Intergenic
1052864599 9:33457328-33457350 GCATCACTGTACTCCAGCCTGGG - Intergenic
1052903509 9:33815699-33815721 ACTCTACTGTACTCCAGCCTGGG + Intergenic
1052926118 9:34017882-34017904 GCGTCACTGTACTCCAGCCTTGG + Intronic
1053085878 9:35221109-35221131 GCTCCACCGCACTCCAGCCTGGG - Intronic
1053217564 9:36285152-36285174 GCGCTACTGTACTCCAGCCTGGG - Intronic
1053368957 9:37544388-37544410 GCTTCACTGCACTCCAGCCTAGG + Intronic
1053550791 9:39077512-39077534 GCTTCACTGCACTCCAGCCTGGG + Intronic
1053814902 9:41897606-41897628 GCTTCACTGCACTCCAGCCTGGG + Intronic
1054615694 9:67289835-67289857 GCTTCACTGCACTCCAGCCTGGG - Intergenic
1054762015 9:69012594-69012616 CCTTTGGCGTAATCCTGCCTGGG - Exonic
1054786228 9:69213104-69213126 GCACCACCGTACTCCAGCCTGGG - Intronic
1055049160 9:71962121-71962143 GCACTACTGTACTCCAGCCTGGG + Intronic
1055270192 9:74549399-74549421 GCATCACCGCACTCCAGCCTGGG + Intronic
1055295636 9:74830435-74830457 GCACTACTGTACTCCAGCCTGGG - Intronic
1055365074 9:75534870-75534892 GCATCACTGTACTCCAGCCTGGG + Intergenic
1055536167 9:77247701-77247723 GCAGTACTGTATTCCAGCCTGGG - Intronic
1055932674 9:81575627-81575649 GCTCCACTGTACTCCAGCCTGGG - Intergenic
1056140500 9:83673842-83673864 GCATCACCGCACTCCAGCCTGGG - Intronic
1056212397 9:84376885-84376907 GCGCTACTGTACTCCAGCCTGGG - Intergenic
1056312046 9:85350820-85350842 GCTTCACTGCACTCCAGCCTAGG - Intergenic
1056414028 9:86359125-86359147 GCACTACTGTACTCCAGCCTGGG + Intergenic
1056592609 9:87975285-87975307 GCGCCACCGTACTCCAGCCTGGG + Intergenic
1056638090 9:88347792-88347814 GCTCCACTGTACTCCAGCCTGGG - Intergenic
1056758136 9:89395379-89395401 GCATCACTGTACTCCAGCCTGGG + Intronic
1056801026 9:89691518-89691540 GTTTCACTGTACTCCAGCCTGGG + Intergenic
1057002058 9:91519158-91519180 TCTCTACCGGAATCAAGCCTCGG - Intergenic
1057674116 9:97123267-97123289 GCGCCACCGTACTCCAGCCTGGG + Intergenic
1058290494 9:103235020-103235042 GCGCCACCGTACTCCAGCCTGGG + Intergenic
1058429871 9:104908616-104908638 GCGCTACCGCACTCCAGCCTGGG + Intronic
1058481276 9:105397903-105397925 GCATCACCGCACTCCAGCCTGGG + Intronic
1058877952 9:109260455-109260477 GCATTACTGCACTCCAGCCTGGG - Intronic
1058992031 9:110263362-110263384 GCTTTACTGCACTCCAGCCTGGG + Intergenic
1059064772 9:111071416-111071438 GCACTACTGTACTCCAGCCTGGG + Intergenic
1059115418 9:111596717-111596739 GCTCCACTGCAATCCAGCCTGGG + Intronic
1059151836 9:111956124-111956146 GCACAACTGTAATCCAGCCTGGG - Intergenic
1059199724 9:112402899-112402921 GCACCACCGTACTCCAGCCTGGG + Intronic
1059500965 9:114753839-114753861 GCTCTACTGCACTCCAGCCTGGG - Intergenic
1059503940 9:114781057-114781079 GCACCACCGTACTCCAGCCTGGG + Intergenic
1060074965 9:120582680-120582702 GCGTCACTGTATTCCAGCCTGGG - Intergenic
1060396043 9:123317678-123317700 GCGTCACCGCACTCCAGCCTGGG + Intergenic
1060482842 9:124027773-124027795 GCACTACTGTACTCCAGCCTGGG + Intronic
1060511222 9:124234210-124234232 GCTTCACTGCACTCCAGCCTGGG - Intergenic
1060576025 9:124695415-124695437 GCATCACTGTACTCCAGCCTGGG - Intronic
1060576920 9:124704451-124704473 GCATCACTGTATTCCAGCCTGGG - Intronic
1060830870 9:126715418-126715440 GTGTTACTGTACTCCAGCCTGGG + Intergenic
1060873996 9:127066853-127066875 GCGCCACCGTACTCCAGCCTGGG - Intronic
1061094706 9:128449032-128449054 GCATCACTGTACTCCAGCCTGGG - Intergenic
1061535012 9:131242237-131242259 GCATTACTGTATTCCAGCCTGGG + Intergenic
1061669577 9:132181124-132181146 GCTTCACTGCACTCCAGCCTGGG - Intronic
1061787587 9:133039444-133039466 GCTCTACTGCACTCCAGCCTTGG - Intronic
1061966962 9:134020382-134020404 GCATCACTGTACTCCAGCCTGGG - Intergenic
1061982244 9:134112606-134112628 GCACTACCACAATCCAGCCTGGG + Intergenic
1062312619 9:135947292-135947314 GCATCATCGTACTCCAGCCTCGG - Intronic
1062666686 9:137677174-137677196 GCGTCACGGCAATCCAGCCTGGG - Intronic
1202798132 9_KI270719v1_random:145971-145993 GCGCCACCGCAATCCAGCCTGGG + Intergenic
1203516168 Un_GL000213v1:3613-3635 GCTCGACTGTACTCCAGCCTGGG - Intergenic
1185548904 X:967984-968006 GCGTCACTGTACTCCAGCCTGGG + Intergenic
1185561649 X:1064469-1064491 GCACCACCGTACTCCAGCCTGGG + Intergenic
1185680214 X:1882375-1882397 GCGCCACCGTACTCCAGCCTGGG - Intergenic
1185727699 X:2435720-2435742 GCATTACTGCACTCCAGCCTGGG + Intronic
1185876973 X:3709829-3709851 GCGCCACCGTACTCCAGCCTGGG - Intronic
1185896675 X:3865107-3865129 GCTCCACTGTACTCCAGCCTGGG + Intergenic
1185901793 X:3903534-3903556 GCTCCACTGTACTCCAGCCTGGG + Intergenic
1186096544 X:6108639-6108661 GCTCTACTGCACTCCAGCCTGGG + Intronic
1186424296 X:9451600-9451622 GCGTCACTGTACTCCAGCCTGGG + Intergenic
1186456417 X:9713468-9713490 GCATCACTGTACTCCAGCCTGGG - Intronic
1186479580 X:9885908-9885930 GCGTCACTGTACTCCAGCCTGGG + Intronic
1186652079 X:11571843-11571865 GCATCACTGTACTCCAGCCTGGG + Intronic
1186793790 X:13024670-13024692 GCGCTACTGTACTCCAGCCTGGG - Intergenic
1186822443 X:13304358-13304380 GCCTTACGGTGCTCCAGCCTGGG - Intergenic
1187123195 X:16429110-16429132 GCCCTACTGTACTCCAGCCTGGG - Intergenic
1187125351 X:16449216-16449238 GCGTCACCGCACTCCAGCCTGGG + Intergenic
1187441254 X:19322676-19322698 GCATCACTGTACTCCAGCCTGGG - Intergenic
1187449256 X:19382199-19382221 GCATTACTGCACTCCAGCCTTGG + Intronic
1187540443 X:20188114-20188136 GCGTCACTGTACTCCAGCCTGGG - Intronic
1187655914 X:21473787-21473809 GCACTACTGTACTCCAGCCTGGG - Intronic
1187666037 X:21610405-21610427 CCTTTCCCTTAAACCAGCCTGGG - Intronic
1187687307 X:21828499-21828521 GCACTACTGTACTCCAGCCTGGG - Intergenic
1187802536 X:23080086-23080108 GCGCCACCGTACTCCAGCCTGGG + Intergenic
1187913061 X:24128377-24128399 GCATCACTGTACTCCAGCCTGGG + Intergenic
1188208400 X:27388466-27388488 GCTCCACTGTGATCCAGCCTGGG - Intergenic
1188287384 X:28344248-28344270 ACATTACTGTACTCCAGCCTGGG - Intergenic
1188444103 X:30238847-30238869 GCTTTACACTAATTCAGACTGGG - Intergenic
1188680565 X:32998324-32998346 GCATTACCACACTCCAGCCTGGG + Intronic
1188701647 X:33271924-33271946 GCATTACTGCACTCCAGCCTGGG - Intronic
1188708358 X:33363346-33363368 GCACTACTGCAATCCAGCCTGGG - Intergenic
1189078398 X:37942538-37942560 GCTATACCATAAACCAGCCCAGG - Intronic
1189263481 X:39694972-39694994 GCATCACTGTACTCCAGCCTGGG + Intergenic
1189427759 X:40916832-40916854 GCTCTACTGCACTCCAGCCTGGG - Intergenic
1189429559 X:40934778-40934800 GCATTACTGCACTCCAGCCTGGG - Intergenic
1189450453 X:41123998-41124020 GCGCCACCGTACTCCAGCCTGGG + Intronic
1189757013 X:44282571-44282593 GCACTACTGCAATCCAGCCTGGG + Intronic
1189762924 X:44341489-44341511 GCATTACTGCACTCCAGCCTGGG - Intronic
1189990794 X:46592411-46592433 GCATCACTGTACTCCAGCCTGGG - Intronic
1190031736 X:46979920-46979942 GCATCACTGTACTCCAGCCTGGG - Intronic
1190043254 X:47089149-47089171 GCATTACTGCACTCCAGCCTGGG + Intronic
1190356052 X:49605863-49605885 GCTCCACTGTACTCCAGCCTGGG + Intronic
1190677204 X:52792474-52792496 GCATCACCGCACTCCAGCCTGGG - Intergenic
1190749630 X:53350462-53350484 GCATTACTGCACTCCAGCCTAGG - Intergenic
1190766774 X:53481659-53481681 GCTCTGCTGTACTCCAGCCTGGG + Intergenic
1190839637 X:54132096-54132118 GTGTTACTGTACTCCAGCCTGGG - Intronic
1190951909 X:55154163-55154185 GCATCACAGCAATCCAGCCTGGG - Intronic
1191744064 X:64466489-64466511 GCTCTACTGCACTCCAGCCTGGG - Intergenic
1192038704 X:67594035-67594057 GCACTACTGTACTCCAGCCTGGG - Intronic
1192395468 X:70776518-70776540 GCATCACTGTACTCCAGCCTGGG + Intronic
1192466862 X:71363442-71363464 GCGCTACTGTACTCCAGCCTGGG - Intergenic
1192550660 X:72050844-72050866 GCGTCACTGTACTCCAGCCTGGG + Intergenic
1193276923 X:79600148-79600170 GCACTACTGTACTCCAGCCTGGG + Intergenic
1193333639 X:80262735-80262757 GCTCCACTGTACTCCAGCCTGGG + Intergenic
1193371153 X:80698664-80698686 GCTCTACTGCACTCCAGCCTGGG + Intronic
1193839382 X:86390630-86390652 GCATCACTGTACTCCAGCCTGGG - Intronic
1193870402 X:86790587-86790609 GCATCACTGTACTCCAGCCTGGG - Intronic
1194682543 X:96871425-96871447 GCGCCACCGTACTCCAGCCTGGG + Intronic
1194722862 X:97360910-97360932 GCATCACTGTACTCCAGCCTGGG - Intronic
1194784338 X:98063303-98063325 GCACTACTGCAATCCAGCCTGGG + Intergenic
1194844941 X:98793979-98794001 ACTTCACTGTACTCCAGCCTGGG - Intergenic
1195054037 X:101125437-101125459 GCATCACTGTACTCCAGCCTAGG - Intronic
1195253874 X:103075099-103075121 GCACTACTGTACTCCAGCCTGGG - Intergenic
1195262146 X:103143177-103143199 GCTCTACCGAGTTCCAGCCTGGG - Intergenic
1195454647 X:105053955-105053977 GTATTACTGTACTCCAGCCTGGG + Intronic
1195797247 X:108664140-108664162 GCGCCACCGCAATCCAGCCTGGG + Intronic
1196322322 X:114355719-114355741 GCGTCACTGTACTCCAGCCTGGG + Intergenic
1196653699 X:118195087-118195109 GCATTACTGTACTCCAGCCTGGG - Intergenic
1196813559 X:119647188-119647210 GCATCACTGTACTCCAGCCTGGG + Intronic
1196923429 X:120608013-120608035 GCTCCACTGTACTCCAGCCTGGG + Intronic
1197197124 X:123713812-123713834 GCTCCACTGTACTCCAGCCTGGG + Intronic
1197785016 X:130190372-130190394 GCATCACTGTACTCCAGCCTGGG + Intergenic
1197907236 X:131438677-131438699 GCTGCACTGTAATCCAGCCTGGG - Intergenic
1198212138 X:134526152-134526174 GCTTCACTGCACTCCAGCCTGGG + Intergenic
1198510476 X:137345982-137346004 GCATCACTGTACTCCAGCCTGGG - Intergenic
1198739117 X:139822237-139822259 GCGCTACCGCACTCCAGCCTGGG - Intronic
1199184688 X:144901458-144901480 GCATCACTGTACTCCAGCCTGGG + Intergenic
1199442595 X:147885467-147885489 GCATCACTGTACTCCAGCCTGGG - Intergenic
1200396379 X:155991388-155991410 GCATCACTGTACTCCAGCCTGGG - Intergenic
1200404692 Y:2797811-2797833 GCATCACTGCAATCCAGCCTGGG + Intergenic
1200589326 Y:5049601-5049623 GCTCAACTGCAATCCAGCCTGGG - Intronic
1200757282 Y:7001574-7001596 GCATTACTGTACTCCTGCCTGGG + Intronic
1200792427 Y:7311741-7311763 GCATCACCGCACTCCAGCCTGGG - Intergenic
1200794868 Y:7331893-7331915 GCACTACTGTACTCCAGCCTGGG - Intergenic
1200947225 Y:8855654-8855676 GCTGTACTGCACTCCAGCCTGGG + Intergenic
1201311185 Y:12599341-12599363 GCACTACTGTACTCCAGCCTGGG - Intergenic
1201316485 Y:12652401-12652423 GCTCTACTGCACTCCAGCCTGGG - Intergenic
1201336767 Y:12890172-12890194 GCGCTACCCTATTCCAGCCTGGG - Intergenic
1201603916 Y:15764286-15764308 GCATCACTGTACTCCAGCCTGGG - Intergenic
1201697384 Y:16840905-16840927 GAGTTACAGTAATGCAGCCTTGG - Intergenic
1201895476 Y:18987744-18987766 GGCTTACTGTACTCCAGCCTGGG - Intergenic
1201905782 Y:19084516-19084538 GCACTACTGTACTCCAGCCTGGG - Intergenic
1202251822 Y:22880769-22880791 GCTCCACCGTGCTCCAGCCTGGG + Intergenic
1202269282 Y:23054594-23054616 GCTTTATTGCATTCCAGCCTGGG + Intergenic
1202404810 Y:24514518-24514540 GCTCCACCGTGCTCCAGCCTGGG + Intergenic
1202422274 Y:24688334-24688356 GCTTTATTGCATTCCAGCCTGGG + Intergenic
1202448512 Y:24981744-24981766 GCTTTATTGCATTCCAGCCTGGG - Intergenic
1202465969 Y:25155564-25155586 GCTCCACCGTGCTCCAGCCTGGG - Intergenic