ID: 972263836

View in Genome Browser
Species Human (GRCh38)
Location 4:37439826-37439848
Sequence GTAGGTGCCTTGTTTATGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 82
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 78}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972263836_972263843 14 Left 972263836 4:37439826-37439848 CCTCTCATAAACAAGGCACCTAC 0: 1
1: 0
2: 0
3: 3
4: 78
Right 972263843 4:37439863-37439885 ATCTTCTTTCTTTTTCCACGTGG 0: 1
1: 0
2: 0
3: 36
4: 415
972263836_972263841 -9 Left 972263836 4:37439826-37439848 CCTCTCATAAACAAGGCACCTAC 0: 1
1: 0
2: 0
3: 3
4: 78
Right 972263841 4:37439840-37439862 GGCACCTACAGTGGGAAATGGGG 0: 1
1: 0
2: 0
3: 14
4: 169
972263836_972263840 -10 Left 972263836 4:37439826-37439848 CCTCTCATAAACAAGGCACCTAC 0: 1
1: 0
2: 0
3: 3
4: 78
Right 972263840 4:37439839-37439861 AGGCACCTACAGTGGGAAATGGG 0: 1
1: 0
2: 1
3: 13
4: 120

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972263836 Original CRISPR GTAGGTGCCTTGTTTATGAG AGG (reversed) Intronic
901142802 1:7046040-7046062 GTGGGTGCCTTGGTTGGGAGGGG + Intronic
908513412 1:64868656-64868678 GTAGCTGCATTGTTTGTGATAGG - Intronic
908518908 1:64921744-64921766 GAAGCTGCCTTGTTTATAAAAGG - Intronic
912952719 1:114131554-114131576 GTGTGTGCCTTGTGTATGAGGGG + Intronic
915265310 1:154712491-154712513 GCAGGTGCCTTGTTTAATAAAGG - Intronic
915941110 1:160118833-160118855 GCAGCTGCCTTGTTCATAAGAGG - Intronic
918778633 1:188668688-188668710 GTAGGACCCATGTTTTTGAGTGG - Intergenic
920019206 1:202941330-202941352 GTAGATGCCTTGCTGAGGAGGGG + Exonic
923142013 1:231168506-231168528 GTAGGTGTCATCTTTATGAAAGG - Intronic
923626707 1:235619916-235619938 GCAGGTTTCTTGTTTAGGAGAGG + Intronic
1069739785 10:70679974-70679996 GTAAGGGCCTTCTTTATGGGAGG + Intronic
1069818018 10:71210881-71210903 GTAGGTGTGATGTTTATGGGAGG + Intergenic
1071174885 10:82914624-82914646 GTAGGATCCCTGTTTATGTGTGG + Intronic
1072031888 10:91529369-91529391 GGAGGTGCTTTGGTTGTGAGAGG - Intergenic
1075653633 10:124146936-124146958 GGAGGTGCCTGGGTTCTGAGTGG - Intergenic
1076724664 10:132407763-132407785 GCAGGTGCCTTGTTGGCGAGTGG + Intronic
1079493553 11:21015799-21015821 GGACGTGCCTGGCTTATGAGGGG - Intronic
1079895365 11:26112934-26112956 GTAGGTGCCTAGTGTATAATTGG + Intergenic
1081171691 11:39877384-39877406 GAAGCTGACTTGTTCATGAGGGG - Intergenic
1086234192 11:84608153-84608175 CTAGGTGCTCTGTGTATGAGAGG - Intronic
1088409666 11:109520353-109520375 GTAGCTGCCTGGTCTATAAGAGG + Intergenic
1096562067 12:52442866-52442888 GTAGATGCCTAGTTTAGGCGAGG + Intergenic
1098005911 12:65996592-65996614 TTAGAAGCCTTGTTTATGTGGGG - Intergenic
1106241752 13:27918698-27918720 GTTGGTGCGTTGTTTAGGAAAGG + Intergenic
1109689682 13:65869414-65869436 TTATGTGCCTTGTTTGGGAGAGG - Intergenic
1112195670 13:97224029-97224051 GAAGATGCCCTATTTATGAGGGG - Intronic
1113786259 13:113003503-113003525 GTAGGTGGCTGCTTTAAGAGAGG + Intronic
1120189106 14:81423772-81423794 GTCGGTTTCTTGTTTGTGAGAGG - Intronic
1124940322 15:34211603-34211625 GTATGTGCCTTGCTTATGCTTGG - Intergenic
1127276453 15:57449527-57449549 GTAGGTCCCCTGATTGTGAGAGG - Intronic
1127561029 15:60136134-60136156 GAAGGTTCCTTGTTTATCACAGG + Intergenic
1131450913 15:92539119-92539141 GTAAGTGCCTTGGCTGTGAGTGG + Intergenic
1133633785 16:7646941-7646963 GTGGGGGCTTTGTTTTTGAGGGG + Intronic
1139140432 16:64255512-64255534 GGAGGTGGGTTGTTTATGATGGG - Intergenic
1141905649 16:87024696-87024718 CTTGGTGCCTTATTTCTGAGTGG - Intergenic
1156021700 18:32606717-32606739 GAAGGTGCTTTTTTTGTGAGTGG + Intergenic
1156901326 18:42303421-42303443 GTAGTTGTCTTGCTTATAAGTGG + Intergenic
1158544870 18:58387729-58387751 GTAGTTGCCTTGTCCATCAGAGG + Intronic
1158560309 18:58507840-58507862 GGAGGTGCTTTGTTTTGGAGAGG - Intronic
1159752193 18:72316197-72316219 GTAGGTGCCTTGTTTTGATGAGG + Intergenic
1160000331 18:75013451-75013473 TTAGGGGCCTTTTTTATTAGAGG - Intronic
931230833 2:60373038-60373060 ATAGGTGCTTTGTTTTTGACAGG + Intergenic
935601793 2:104929527-104929549 GTAGTTGCCTGGTTTATGAACGG + Intergenic
943251641 2:185528824-185528846 CTAGGTGCATTGTTAATGAGCGG + Intergenic
948401132 2:237686508-237686530 GTAGGTGCCTTATAAATGATGGG - Intronic
1170496386 20:16929311-16929333 GTAGGTGCCTATGTTATCAGGGG + Intergenic
1173981243 20:47225669-47225691 GTAGTTAACTTCTTTATGAGGGG - Intronic
949553567 3:5132812-5132834 GTATGTGCCATGTATAGGAGAGG + Intronic
949976894 3:9468912-9468934 GTAGGAGCCTTGTTAAAGAAAGG + Intronic
950224501 3:11222787-11222809 GTAAGGGCCTTGATTAGGAGTGG - Intronic
959033606 3:101333630-101333652 GTAGTTTCCTTGTGTATGAAAGG - Intronic
971813269 4:31455576-31455598 GTAGGTGCCTTCACTATGACAGG - Intergenic
972263836 4:37439826-37439848 GTAGGTGCCTTGTTTATGAGAGG - Intronic
975298409 4:72761236-72761258 GTAGGTGCCTTGTTTGTTGAAGG + Intergenic
977965132 4:103137199-103137221 GCAGTTTCCTTGTTTATGAATGG + Intronic
982874006 4:160622179-160622201 ATAGGTGTCTGGTTTATCAGAGG + Intergenic
984660857 4:182373622-182373644 GGAGGTGTCTGGATTATGAGGGG - Intronic
990484491 5:56244374-56244396 ATAGGTGCCAAGTTGATGAGGGG + Intergenic
1000246181 5:159450174-159450196 GTACCGGCCTTGTTTATCAGAGG + Intergenic
1000388756 5:160701274-160701296 GTCTGTGTCTAGTTTATGAGGGG - Intronic
1001479604 5:172078889-172078911 GAAGTTGCCTAGTTTAGGAGGGG - Intronic
1004287775 6:14338514-14338536 GTAGGTGCATTGTGTTTTAGGGG + Intergenic
1007365868 6:41392256-41392278 GTAGATGCATTGTTTGTTAGAGG - Intergenic
1008522093 6:52371881-52371903 GCAGATGCCTTGTTTGTGTGGGG + Intronic
1008579373 6:52892064-52892086 GGGGCTGCCTTGTTCATGAGAGG - Intronic
1012059998 6:94466263-94466285 GTAGCTGCCTTTCTTAGGAGGGG + Intergenic
1014493693 6:122093102-122093124 GTAAGGGCCTTGGTTAAGAGAGG + Intergenic
1030020033 7:105264524-105264546 GTAGCTGTCTTGTTCAGGAGAGG - Intronic
1031942538 7:127804360-127804382 GAAGGTGCCTTGTTTTTTATTGG + Intronic
1035868400 8:3110068-3110090 ATATGTGCCTTGTATATAAGTGG + Intronic
1038086801 8:24206955-24206977 GTAGGACGCTTGTTTATAAGAGG - Intergenic
1038883533 8:31639815-31639837 GTAGGAGAGTTGTTTATGGGAGG - Intronic
1040441340 8:47446420-47446442 CTAGGTGCATTGTCAATGAGGGG - Intronic
1045266593 8:100623716-100623738 GGAGGGGCCTTGATTATCAGTGG - Intronic
1049357215 8:142194921-142194943 ACAGGTGCCTTGTTCATGTGGGG + Intergenic
1051741094 9:20253033-20253055 GTGGGTGCCTTGTTTCTAACAGG - Intergenic
1052048230 9:23819951-23819973 GTAGGGGCCTTCTTTATAGGAGG - Intronic
1055311447 9:74985917-74985939 CTTAGTGCCTTGTTTATGACAGG - Intronic
1185870328 X:3659356-3659378 GTAAGAGCCTTTTTTATAAGAGG - Intronic
1186582137 X:10831405-10831427 GTAGGTGCCCTGGTTAAAAGAGG - Intronic
1194763350 X:97820169-97820191 GCAGTTGCCTTGGTCATGAGGGG - Intergenic
1198639916 X:138745477-138745499 GTTGGTGCCTTGTTGTTGGGAGG - Intronic