ID: 972263971

View in Genome Browser
Species Human (GRCh38)
Location 4:37440723-37440745
Sequence ACCATCATGCAGGACTTGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 196
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 180}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972263971_972263974 -6 Left 972263971 4:37440723-37440745 CCTTTCAAGTCCTGCATGATGGT 0: 1
1: 0
2: 0
3: 15
4: 180
Right 972263974 4:37440740-37440762 GATGGTCTGGAACCTCACTTTGG 0: 1
1: 0
2: 0
3: 10
4: 107
972263971_972263977 16 Left 972263971 4:37440723-37440745 CCTTTCAAGTCCTGCATGATGGT 0: 1
1: 0
2: 0
3: 15
4: 180
Right 972263977 4:37440762-37440784 GAATGTGGTATCTGCTGAGTTGG 0: 1
1: 0
2: 0
3: 16
4: 165
972263971_972263975 1 Left 972263971 4:37440723-37440745 CCTTTCAAGTCCTGCATGATGGT 0: 1
1: 0
2: 0
3: 15
4: 180
Right 972263975 4:37440747-37440769 TGGAACCTCACTTTGGAATGTGG 0: 1
1: 0
2: 2
3: 15
4: 203

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972263971 Original CRISPR ACCATCATGCAGGACTTGAA AGG (reversed) Intronic
900699469 1:4035206-4035228 AACATGATACAGGACATGAAAGG + Intergenic
901875458 1:12164805-12164827 ACCATCCTGTAGGAGCTGAAGGG + Intergenic
904863191 1:33555971-33555993 ACCCTCATGCATGACTTTGATGG + Intronic
905654396 1:39676783-39676805 CCGATCATGCAGGACCTGGAGGG + Intergenic
905732647 1:40307247-40307269 GCCAACATGGAGGACTGGAATGG + Intronic
906337450 1:44946040-44946062 ACAATTATGCAGGACTTGTTTGG - Intronic
909179854 1:72409552-72409574 ACCATCCTACTTGACTTGAAGGG + Intergenic
909382055 1:75009927-75009949 ACTATCATGGTGGAGTTGAAGGG - Intergenic
909393172 1:75137352-75137374 ACCTTCACCCAGAACTTGAACGG - Intronic
910437630 1:87221076-87221098 ACCCTCAGCCAGGACTTGAAAGG - Intergenic
910588087 1:88900779-88900801 ACCACCATCAAGGACTTGAAAGG + Intergenic
911832149 1:102564027-102564049 ACCGTCATGGACGACTTCAAGGG + Intergenic
912663134 1:111552646-111552668 ACCACCAGGCAGGCCTTGAGAGG + Intronic
915600290 1:156918858-156918880 ACCCTCATGGATGACTTGGAGGG + Intergenic
918694492 1:187527377-187527399 ACCATCATGGATGACTTTGAAGG + Intergenic
919077135 1:192827199-192827221 AACATTATCCAGGAATTGAAAGG + Intergenic
919530695 1:198715582-198715604 AACATCATGGTGGTCTTGAAAGG - Intronic
920575655 1:207058357-207058379 ACCATCCTTCAGGATTAGAATGG + Intronic
921405153 1:214770897-214770919 ACCCTCATGCATGACTTTGAGGG - Intergenic
922094712 1:222433463-222433485 AAAATTATGGAGGACTTGAATGG - Intergenic
1063453714 10:6168669-6168691 ACCATTATGCATGAGTTTAACGG + Intronic
1066260400 10:33724206-33724228 CCCATCATGCAGGAGTGGACAGG + Intergenic
1067333025 10:45339264-45339286 GCCATGATCAAGGACTTGAAAGG + Intergenic
1071330665 10:84556086-84556108 ACAATCATGGAGGAAGTGAAAGG + Intergenic
1072385550 10:94922850-94922872 ACCATCATAGATGACTTGGAGGG + Intergenic
1072477074 10:95772645-95772667 ACCCTCATGAATGACTTGGAGGG - Intronic
1073027400 10:100497999-100498021 CCCATCATGCAGGAGAAGAAGGG - Intronic
1074303109 10:112250789-112250811 ACTGGTATGCAGGACTTGAAAGG + Intergenic
1074725401 10:116303074-116303096 ACATTCATGGATGACTTGAAGGG - Intergenic
1075178786 10:120190829-120190851 ACTTTCATGGATGACTTGAAGGG - Intergenic
1075193447 10:120332853-120332875 ACCCTCATGGATGACTTGGAGGG + Intergenic
1077423999 11:2466007-2466029 ACACTCATGCAGGCCCTGAAGGG - Intronic
1081261642 11:40969120-40969142 ACCATCATGGATGACTTTGACGG + Intronic
1084277924 11:68065062-68065084 CCCATCATTCAGGACAGGAAAGG + Intronic
1086911666 11:92479529-92479551 AAAATCATGCAGGCCTTGAATGG + Intronic
1087295424 11:96367615-96367637 ACCCTCCTGGATGACTTGAAGGG - Intronic
1088175624 11:107050201-107050223 ACAAAAATGCAGGCCTTGAAAGG - Intergenic
1088947318 11:114527706-114527728 TCAATCATGCTGGACTTTAAAGG - Intronic
1091948169 12:4567943-4567965 TCCCTCATGCAGGACTCAAATGG + Intronic
1092364702 12:7867377-7867399 ACCATCATGGATGACTTTGATGG + Intronic
1093295872 12:17391029-17391051 ACCATCATACTGGAGTTGAGTGG + Intergenic
1094408031 12:30139455-30139477 AACATCATGAAAGAATTGAAGGG + Intergenic
1095518318 12:43032008-43032030 ACCCCCATGAAGGACTTGGAGGG - Intergenic
1095688027 12:45057754-45057776 ACCTTCATGCATTACTTTAAGGG - Intergenic
1098596766 12:72281589-72281611 AACAGCATGGATGACTTGAAAGG - Intronic
1098658699 12:73067156-73067178 GCCACCATCAAGGACTTGAAAGG + Intergenic
1098800553 12:74951997-74952019 ACCTTCATGGATGACTTTAAAGG - Intergenic
1099060214 12:77898941-77898963 ACTATTATGGATGACTTGAAGGG + Intronic
1099674195 12:85736445-85736467 ACCATCACTCTGGCCTTGAAGGG + Intergenic
1100736297 12:97537260-97537282 ATCATCAAGCAGGACTCAAATGG - Intergenic
1101900403 12:108787802-108787824 ACCAACATGCAGCACAAGAAGGG - Exonic
1102181453 12:110915683-110915705 ACCCTCATGCAGGGCTAGAGAGG + Intronic
1106785666 13:33106038-33106060 AGCATCATGAATGCCTTGAAGGG + Intronic
1108965671 13:56297346-56297368 ACCCTCATGGATGACTTTAAGGG + Intergenic
1109375706 13:61489411-61489433 ACCATCATGTAAGTCTTTAATGG - Intergenic
1109733851 13:66454589-66454611 CTCTTCATGGAGGACTTGAATGG + Intronic
1110250928 13:73379675-73379697 AGCATCATGCAGATCTTGCAAGG + Intergenic
1110411550 13:75209164-75209186 ACCCTCATGGATGACTTGGAGGG - Intergenic
1110829635 13:80015860-80015882 ACCCTAATGGATGACTTGAAGGG + Intergenic
1112836670 13:103523090-103523112 ACCCTCATGAATGACTTTAAGGG + Intergenic
1114439736 14:22736632-22736654 ACCTTAATGCAGGAGCTGAAGGG - Intergenic
1114591877 14:23873186-23873208 ACCCTCATGGATGACTTGGAGGG - Intergenic
1114977435 14:28119335-28119357 ACCTTCATGGATGACTTGGAGGG + Intergenic
1115043580 14:28961159-28961181 ACCATCATGGATGACTTGGAGGG - Intergenic
1115070698 14:29318651-29318673 GCCATCATCCAGCACTTGAAAGG + Intergenic
1115411052 14:33075422-33075444 AACATCATGAAGAACTTTAATGG - Intronic
1116320347 14:43454424-43454446 TCCAGCCTGCAGGATTTGAAGGG + Intergenic
1118707923 14:68496783-68496805 ACCCTCATGAATGACTTCAAGGG + Intronic
1122818918 14:104331067-104331089 ACCATCATGGATGACTTTGAGGG - Intergenic
1125822552 15:42645071-42645093 ACCCTCATGAATGACTTTAAGGG - Intronic
1130120242 15:81041732-81041754 ACCATCATGTGGGGCTTGTATGG + Intronic
1132299926 15:100769009-100769031 GCCTCCATGCAGGACTTGCATGG - Intergenic
1133169816 16:3975315-3975337 ACTGTCATTCAGTACTTGAAAGG - Intronic
1133976465 16:10602706-10602728 ACAATCATACAGGACTTCCATGG + Intergenic
1134094510 16:11410862-11410884 CCCTGCATGCAGGACTTGAGGGG - Intronic
1134227805 16:12405111-12405133 ACCACAATGCAGAACTTGAAGGG - Intronic
1139081988 16:63533338-63533360 ACCTTCATGCATGACTTTGAGGG - Intergenic
1141183951 16:81773903-81773925 CCCATCATGCAGGACTTTGATGG + Intronic
1144386824 17:14755803-14755825 GCCATCCTGCAGAACTTGCATGG + Intergenic
1147122353 17:38343251-38343273 ACCATCCTGCAGGACTTGTCTGG - Exonic
1149219479 17:54399576-54399598 ACCCTCATGGATGACTTTAAGGG + Intergenic
1154370530 18:13757668-13757690 ACCCTCATGCATGACTTCAAGGG - Intronic
1155322620 18:24633579-24633601 AATATCCTGCAGGACCTGAAGGG + Intergenic
1155743194 18:29316106-29316128 ACCATCATGCAGGTCAAGCAAGG - Intergenic
1157373223 18:47137831-47137853 ACCAAGATGCTTGACTTGAAGGG - Intronic
1159892451 18:73965417-73965439 ACAATCATGCAGAAGGTGAAAGG + Intergenic
1160166030 18:76513263-76513285 ACCCTCATGCATGACTTGGAGGG - Intergenic
1161763124 19:6188893-6188915 ACTGGTATGCAGGACTTGAAAGG + Intronic
1161957665 19:7505600-7505622 ACCTTCATGCAGTACTTCTACGG + Exonic
1162087592 19:8257870-8257892 ACCATCTTACAGGCCTGGAAAGG - Exonic
929081992 2:38130183-38130205 ACCATCATGCAGGCCCCCAATGG + Intergenic
930991673 2:57663680-57663702 GCCCTCATGCATGACTTTAAGGG - Intergenic
935362721 2:102261301-102261323 ACCAGGATGCAGGACTCAAAGGG + Intergenic
935796804 2:106650135-106650157 AACCTCATGGAGGACTTTAAGGG - Intergenic
936913324 2:117614912-117614934 ACCAACAGGCAGGATTTGAAAGG - Intergenic
939786986 2:146527131-146527153 ACCCTCATGGATGACTTTAAGGG + Intergenic
941371184 2:164666875-164666897 ACCCTCATGGATGACTTGGAAGG - Intronic
945989585 2:216383887-216383909 ACCCTCATGGATGACTTTAAGGG + Intergenic
948107255 2:235424898-235424920 ACCTTCATGGATGACTTTAAGGG + Intergenic
1170116812 20:12869280-12869302 GCCATGATGCAGGACATGGAAGG + Intergenic
1171236600 20:23531454-23531476 ACCATCATGAATGACTTTGAGGG - Intergenic
1172804866 20:37604566-37604588 ATGACCATGCAGGTCTTGAAAGG + Intergenic
1173447099 20:43129027-43129049 ACCCTCATGCAGGACCTTCAAGG - Intronic
1175412557 20:58780354-58780376 TGCATCATGCAGGACTTCTAGGG + Intergenic
1175464199 20:59179002-59179024 CCCAGCATGAAGGACTTGAAGGG + Intergenic
1177044133 21:16148304-16148326 ATCCTCATGGATGACTTGAAGGG + Intergenic
1177447954 21:21222507-21222529 CCCTTCATGGAGGACTTGAGAGG + Intronic
1178100438 21:29262751-29262773 ACCCTCATGCATGACTTTGAGGG - Intronic
1178411373 21:32366310-32366332 ATCCTCAGGCAGGACTAGAAAGG + Intronic
1178781625 21:35608946-35608968 ACCTTCATGTAAGATTTGAAAGG + Intronic
1180482723 22:15769683-15769705 ATGATCAAGCAGAACTTGAAGGG - Intergenic
1185144915 22:49127419-49127441 ACAATCATGCAGAAGGTGAAAGG + Intergenic
950766760 3:15278495-15278517 AGCATCATTCAGGAGTTGAAGGG - Intronic
951529967 3:23689216-23689238 ACCTTCATGGATGTCTTGAAGGG - Intergenic
953771836 3:45783488-45783510 AACATCATGCAGCTCTTTAAGGG - Intronic
955820555 3:62891592-62891614 AACTTCAAGCAGGACTTGAGGGG - Intergenic
957877514 3:86167929-86167951 AGCTTCTTGCAAGACTTGAAAGG - Intergenic
959177572 3:102934746-102934768 ACCCTCATGGATGACTTCAAGGG + Intergenic
966061890 3:175767915-175767937 GTCATCATGCAGGATTTGGAAGG - Intronic
970048968 4:11889676-11889698 AACATCACATAGGACTTGAAGGG + Intergenic
970072756 4:12180158-12180180 TCCATCATGCATGACTTAATGGG - Intergenic
970199659 4:13590744-13590766 AAAATCATGCAGGATTTGGATGG - Intronic
970605288 4:17674936-17674958 ACCCTCATGGATGACTTGGAGGG - Intronic
972263971 4:37440723-37440745 ACCATCATGCAGGACTTGAAAGG - Intronic
975568075 4:75781156-75781178 ACCCTCATGGATGACTTGGAGGG + Intronic
976240685 4:82953274-82953296 GCCAGCATGCAAGACTGGAACGG + Intronic
977104108 4:92858402-92858424 ACCATCATACATGACTTTTAAGG + Intronic
978920412 4:114176392-114176414 ACAATCATGCAGAAGGTGAAAGG + Intergenic
979729344 4:124005108-124005130 ACCCTCATGCATGACTTTGAGGG - Intergenic
979973916 4:127172182-127172204 ACCCTCATGGATGACTTGGAGGG + Intergenic
981898940 4:149838930-149838952 ACCTTCATGGATGACTTGGAGGG - Intergenic
982439061 4:155413480-155413502 AACATCATTCATGAATTGAATGG - Intergenic
982763871 4:159321147-159321169 AAGATCATGCTGGACTTTAAAGG - Intronic
983489712 4:168374153-168374175 ACCATCTCGCTGGACTTGGAAGG + Intronic
987036825 5:14027551-14027573 ACCATAATACTTGACTTGAATGG - Intergenic
987536090 5:19189648-19189670 ACCAACAAGTAGGAATTGAAGGG + Intergenic
987835782 5:23159588-23159610 ACCTTCAAGCAGGAGCTGAAGGG + Intergenic
989562664 5:42870074-42870096 AACATGATACAGGACATGAAAGG - Intronic
989650974 5:43689761-43689783 AACATGATGCAGGATATGAAAGG + Intronic
991186451 5:63814528-63814550 ACAATCATGCAGAAAGTGAAGGG - Intergenic
991193445 5:63903492-63903514 ACCTTCAGGCAAGACTCGAAAGG + Intergenic
995628844 5:114110835-114110857 ACCATCATTCAGCAAATGAATGG - Intergenic
996673304 5:126144946-126144968 ACCCTCATGGAGGACTTTGAGGG + Intergenic
997230975 5:132242898-132242920 AACATGATACAGGATTTGAAAGG - Intronic
997479233 5:134171089-134171111 ACCAGAATACAGGACTTTAAAGG + Intronic
999156070 5:149458437-149458459 TCGCTCATCCAGGACTTGAACGG - Intergenic
1004301596 6:14463366-14463388 ACCATCATGCAGCTGTTGCAAGG - Intergenic
1005432602 6:25774286-25774308 TCCATCCAGCAGGAATTGAAAGG - Intronic
1012205516 6:96456190-96456212 ACCATCATCAAAGACATGAAAGG + Intergenic
1012968632 6:105702963-105702985 ACAATCATGCAGAAGGTGAAAGG - Intergenic
1017721682 6:157247355-157247377 ACCTTCCTGCAGGGATTGAATGG + Intergenic
1018271294 6:162081129-162081151 ACCCTCATGGATGACTTTAAGGG - Intronic
1022566764 7:31411490-31411512 ACCCTCATGGATGACTTTAAGGG + Intergenic
1023393398 7:39731568-39731590 CAGATCATGAAGGACTTGAATGG + Intergenic
1023778352 7:43632378-43632400 ATCCTCATGGAGGACTTGGAGGG - Intronic
1027573589 7:79903229-79903251 ACCCTCATGGATGACTTGGAGGG + Intergenic
1027835707 7:83238830-83238852 ACAATCATGCAGAAGGTGAAAGG + Intergenic
1031194555 7:118596171-118596193 ACCAGCATGGAGGGCTAGAAAGG - Intergenic
1031937281 7:127748782-127748804 ACATTCAAGCAGGTCTTGAAGGG + Intronic
1033468840 7:141624529-141624551 ACCCTCATGGATGACTTTAAGGG + Intronic
1033904782 7:146189405-146189427 ATCCTCATGCAAGCCTTGAATGG - Intronic
1034902950 7:154919004-154919026 ACCTTCAAGCAGGAGCTGAAGGG - Intergenic
1035344122 7:158187247-158187269 ACCAGCATGAAGGCCCTGAAAGG + Intronic
1035387245 7:158481959-158481981 ACCCTCATGCATGACTTTCAGGG + Intronic
1038515897 8:28187513-28187535 ACCATCATGCAGGTCTCCTAAGG - Intronic
1042575092 8:70209128-70209150 ACCCTCATGGATGACTTGGAGGG + Intronic
1043204371 8:77417479-77417501 ACCCTCATGGATGACTTTAATGG + Intergenic
1044089685 8:87983740-87983762 ACCATCATGAATGACTTTGAGGG - Intergenic
1045073065 8:98531035-98531057 ACCCTCATGGATGACTTTAAGGG - Intronic
1045218935 8:100178150-100178172 CCCAAGATGCAGGACTTCAAAGG - Intronic
1045355295 8:101382762-101382784 ACCATCATGAATGACTTTGAAGG - Intergenic
1045842698 8:106598112-106598134 ACCATCATGTAGGACTCTAAAGG - Intronic
1046029369 8:108765318-108765340 TCCATCATCCTGGACTTTAAGGG + Intronic
1050349487 9:4726647-4726669 ACCCTCATGGATGACTTTAAGGG - Intronic
1050649942 9:7765274-7765296 ACCCTCATGAATGACTTGAGGGG + Intergenic
1052193454 9:25684045-25684067 ACCATCCTCCAGGACTGGAATGG + Intergenic
1052986539 9:34491970-34491992 GCCATCCAGGAGGACTTGAAGGG - Intronic
1055547352 9:77393330-77393352 ACCATCATGGATGACTTTGAGGG - Intronic
1056897171 9:90561820-90561842 TCCATCATGGAAGACTTCAAGGG + Intergenic
1057132364 9:92663038-92663060 ATCCTCATGCATGTCTTGAAGGG - Intronic
1057191059 9:93087965-93087987 ACCACCATGCAGGACGGGACAGG + Intergenic
1057877657 9:98770243-98770265 ACAATCATGCAGAAGCTGAAAGG - Intronic
1059700491 9:116771196-116771218 ATCATCACACAGGACTTGTAGGG + Intronic
1060260811 9:122072085-122072107 ACCATCATGCAGGCCTACACTGG - Intronic
1185626315 X:1484815-1484837 GCAAACACGCAGGACTTGAATGG - Intronic
1186538046 X:10370095-10370117 ACCATCAAGCAGGGTCTGAATGG - Intergenic
1187776318 X:22762425-22762447 ACCATCATACATCACTGGAAAGG - Intergenic
1188278635 X:28235238-28235260 ACAATCATACAGGATTTAAAGGG + Intergenic
1188395410 X:29676779-29676801 ACCTTCATGAAGAACTTGACAGG - Intronic
1189945964 X:46179522-46179544 AGCATGATACAGGACATGAAAGG - Intergenic
1194181027 X:90712920-90712942 ACCTTCATGAATGACTTCAATGG + Intergenic
1195006850 X:100693535-100693557 ACCATCATGTAGCTCTTGGATGG + Intronic
1195133877 X:101883819-101883841 ACCATCAAGCAGGTCATAAACGG - Exonic
1198323030 X:135538488-135538510 ACCTTCATGGATGACTTTAAGGG - Intronic
1198604422 X:138321642-138321664 AACATAATGCAGGATATGAAAGG - Intergenic
1200527642 Y:4294791-4294813 ACCTTCATGAACGACTTCAATGG + Intergenic