ID: 972265316

View in Genome Browser
Species Human (GRCh38)
Location 4:37453907-37453929
Sequence GGCGGCCGCTGCGAGCTCGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972265307_972265316 15 Left 972265307 4:37453869-37453891 CCGGGCCACGTGACGCGCGGGCC No data
Right 972265316 4:37453907-37453929 GGCGGCCGCTGCGAGCTCGGCGG No data
972265308_972265316 10 Left 972265308 4:37453874-37453896 CCACGTGACGCGCGGGCCCAATG No data
Right 972265316 4:37453907-37453929 GGCGGCCGCTGCGAGCTCGGCGG No data
972265303_972265316 22 Left 972265303 4:37453862-37453884 CCGCAGCCCGGGCCACGTGACGC No data
Right 972265316 4:37453907-37453929 GGCGGCCGCTGCGAGCTCGGCGG No data
972265313_972265316 -6 Left 972265313 4:37453890-37453912 CCCAATGACAGCGCTGGGGCGGC No data
Right 972265316 4:37453907-37453929 GGCGGCCGCTGCGAGCTCGGCGG No data
972265314_972265316 -7 Left 972265314 4:37453891-37453913 CCAATGACAGCGCTGGGGCGGCC 0: 1
1: 0
2: 0
3: 2
4: 96
Right 972265316 4:37453907-37453929 GGCGGCCGCTGCGAGCTCGGCGG No data
972265306_972265316 16 Left 972265306 4:37453868-37453890 CCCGGGCCACGTGACGCGCGGGC No data
Right 972265316 4:37453907-37453929 GGCGGCCGCTGCGAGCTCGGCGG No data
972265302_972265316 23 Left 972265302 4:37453861-37453883 CCCGCAGCCCGGGCCACGTGACG No data
Right 972265316 4:37453907-37453929 GGCGGCCGCTGCGAGCTCGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972265316 Original CRISPR GGCGGCCGCTGCGAGCTCGG CGG Intergenic
No off target data available for this crispr